tipinė forma
patvirtinta Viešųjų pirkimų tarnybos
prie Lietuvos Respublikos Vyriausybės
direktoriaus 2006 m. sausio 19 d. įsakymu Nr. 1S-4
(Viešųjų pirkimų tarnybos direktoriaus 2011 m.
liepos d. įsakymo Nr. 1S- redakcija)
S
p
a
u
d
a
s
Pildo VPT darbuotojas


Nacionalinė visuomenės sveikatos priežiūros laboratorija
(Perkančiosios organizacijos pavadinimas)
 
Juridinių asmenų registras, 195551983, Žolyno g. 36, 10210 Vilnius, Tel.: (8 5) 270 9229
 
Viešųjų pirkimų tarnybai  
 
 

20    m.                        d. Nr.      

I. BENDRA INFORMACIJA APIE PIRKIMĄ
I. PIRKIMO NUMERIS
51826   
2. AR PIRKIMAS YRA SUSIJĘS SU PROJEKTU IR/ARBA PROGRAMA,
FINANSUOJAMA EUROPOS SĄJUNGOS LĖŠOMIS?  
  TAIP          NE  
3. AR PIRKIMAS ATLIEKAMAS CENTRINĖS VIEŠŲJŲ PIRKIMŲ
INFORMACINĖS SISTEMOS PRIEMONĖMIS? 

(kaip numatyta Viešųjų pirkimų įstatymo 151 straipsnyje, elektroninis pirkimas)
  TAIP          NE  
II. PERKANČIOJI ORGANIZACIJA
1. PERKANČIOSIOS ORGANIZACIJOS TIPO KODAS  1

2. AR PIRKIMO ĮGALIOJIMAI BUVO SUTEIKTI KITAI PERKANČIAJAI ORGANIZACIJAI?
(jeigu taip, pildyti 2.1 papunktį)
  TAIP          NE  
2.1. Įgaliotosios organizacijos pavadinimas, kodas, adresas ir tipas

Pavadinimas
 
Kodas
   
Adresas, telefonas
  
Organizacijos tipo kodas
   

III. PIRKIMO OBJEKTAS

1. AR ŠIS PIRKIMAS ATLIEKAMAS SIEKIANT SUDARYTI PRELIMINARĄJĄ PIRKIMO SUTARTĮ   TAIP          NE  

2. PREKIŲ PIRKIMO TIPAS     (pažymimas tik vienas iš langelių)
Pirkimas Nuoma Lizingas Pirkimas išsimokėtinai Mišrus
3. PASLAUGŲ KATEGORIJA
      ( pagal Viešųjų pirkimų įstatymo 2 priedėlį ) 
4. DARBŲ TIPAS     (pažymimas tik vienas iš langelių)
Atlikti darbus Atlikti ir suprojektuoti darbus Bet kokiomis priemonėmis atlikti darbus, atitinkankčius
perkančiosios organizacijos nustatytus reikalavimus
5. PIRKIMO OBJEKTO PAVADINIMAS
Medikamentų, reagentų, diagnostikumų, laboratorinių priemonių, mitybinių terpių pirkimas 
6. PAGRINDINIS PIRKIMO OBJEKTO KODAS PAGAL BVPŽ
  33100000-1
7. PAPILDOMI PIRKIMO OBJEKTO KODAI PAGAL BVPŽ (jei yra)
  24641250-6
24496500-2
25200000-3
36712000-5
24100000-5
26100000-9
24250000-1
27521500-8
25161200-9
26241000-9
33141625-7
25240000-5
24494000-3
24122400-9
33124110-9
33141310-6
26152330-0
26152339-3
33141411-4
33141112-8
33141114-2
33141110-4
33169000-2
33141115-9
33190000-8
26131000-5
24495000-0
25221000-6
33141320-9
24111100-6
24147000-6
24133320-4
24133310-1
24133000-5
24142220-9
24133120-2
25171000-0
36731000-4
36712200-7
25223200-2
27140000-8
26241300-2
24132120-5
24144100-6
24142400-5
24146200-1
24142000-1
24143210-3
24151300-0
24133300-8
24135000-9
24143200-0
24151100-8
24141120-1
24141300-7
24146320-8
24131470-6
24210000-9
24141221-9
24142310-7
24131000-1
24141000-4
24134200-4
24144200-7
24134100-3
24141224-0
24121000-8
24142210-6
24131130-1
24131520-2
24131522-6
24134000-2
24133124-0
24135200-1
24132200-0
24131420-1
24142500-6
24131411-5
24135300-2

8. PIRKIMO OBJEKTO DALYS, DĖL KURIŲ TIEKĖJAI BUVO PRAŠOMI PATEIKTI ATSKIRUS PASIŪLYMUS
(pildyti, jeigu pirkimo objektas skirstomas į dalis)
Pirkimo objekto dalies numeris Pavadinimas Pirkimo objekto kodas pagal BVPŽ
1 DIAGNOSTIKUMAI IR REAGENTAI MIKROBIOLOGIJAI Rinkinys tirpaus Legionella antigeno aptikimui šlapime 33141625-7
2 Agliutinaciniai serumai Legionella pneumophila sg. 1 33141625-7
3 Agliutinaciniai serumai Legionella pneumophila sg. 2-14 33141625-7
4 Agliutinaciniai serumai Legionella species 33141625-7
5 Staphytect Plus 33141625-7
6 Lateksinis testas PBP'2 baltymui 33141625-7
7 Testas Beta-laktamazių aktyvumo nustatymui - Nitrocephin (cefinazė) 33141625-7
8 PYR testas 33141625-7
9 Streptokokų grupavimo rinkinys lateks agliutinacijos metodu (grupės A,B,C,D,F,G) 33141625-7
10 Pneumokokų lateks agliutinacijos rinkinys (diagnostikai) 33141625-7
11 Antiserumų rinkinys S.pneumoniae serotipavimui latex agliutinacijos metodu 24496500-2
12 Imunochromatografinis testas antigeno E.coli 0157 nustatymui išmatuose 33141625-7
13 C.difficile toksino nustatymo testas 33141625-7
14 Roto virusų nustatymo išmatose diagnostikumas 33141625-7
15 Astro virusų nustatymo išmatose diagnostikumas 33141625-7
16 Noro virusų nustatymo išmatose diagnostikumas 33141625-7
17 Chlamydia trachomatis IF diagnostinis rinkinys ir priemonės Chlamydia trachomatis diagnostinis rinkinys 33141625-7
18 Chlamydia trachomatis IF paėmimo priemonės 33141625-7
19 Diagnostiniai reagentai Liofilizuota triušio plazma 24496500-2
20 Kovačio reagentas 24496500-2
21 Geležies chloridas 24496500-2
22 Oksidazės reagentas 24496500-2
23 Optochino diskai 24496500-2
24 Bacitracino diskai 24496500-2
25 Difterijos antitoksinis serumas(diagnostinis, gali būti ir gydomasis) 24496500-2
26 Indoxyl acetato diskai 24496500-2
27 ONPG diskai 24496500-2
28 Dulcito diskai 24496500-2
29 Adonito diskai 24496500-2
30 Rafinozės diskai 24496500-2
31 Melibiozės diskai 24496500-2
32 Tregalozės diskai 24496500-2
33 Voges-Proskauer A droperiai 24496500-2
34 Voges-Proskauer B droperiai 24496500-2
35 D-Tartratas 24496500-2
36 Mukatinė rūgštis 24496500-2
37 KOH 24496500-2
38 Salmoneliozinis bakteriofagas (skystas) 24496500-2
39 Neslerio reagentas 24100000-5
40 Imunomagnetinės dalelės su E.coli O157 antikūnais 33141625-7
41 Imersinis aliejus 24496500-2
42 Biologiniai indikatoriai Biologiniai indikatoriai drėgnojo sterilizavimo įrangos biologinei kontrolei su Bacillus stearothermophilus sporomis 33141625-7
43 Biologiniai indikatoriai karšto oro sterilizavimo įrangos biologinei kontrolei su Bacillus subtilis sporomis 33141625-7
44 Faktoriai hemofilų identifikavimui X faktorius 24496500-2
45 V faktorius 24496500-2
46 XV faktoriai 24496500-2
47 Atmosferos sąlygų sudarymo sistemos Anaerobinių sąlygų sudarymo sistema (1-4 lėkštelėms) 24496500-2
48 Anaerobinių sąlygų sudarymo sistema (2,5 l indui) 24496500-2
49 Mikroaerofilinių mikroorganizmų (Kampylobakterijų) auginimo sąlygų sudarymo sistema (1-4 lėkštelėms) 24496500-2
50 Mikroaerofilinių mikroorganizmų (Kampylobakterijų) auginimo sąlygų sudarymo sistema (2,5 l indui) 24496500-2
51 Anaerobinių sąlygų susidarymo indikatoriai 24496500-2
52 Atmosferos sąlygų sudarymo sistemai plastikiniai maišeliai 25240000-5
53 IDENTIFIKACINĖS SISTEMOS Neiserijų, Hemofilų identifikacinė sistema Neiserijų-Hemofilų plokštelės 24496500-2
54 Mėgintuvėliai su inokuliavimo skysčiu 24496500-2
55 Nitratų A reagentas 24496500-2
56 Nitratų B reagentas 24496500-2
57 Indolo reagentas 24496500-2
58 Plokštelė mielių grybų identifikavimui ir jautrumui priešgrybiniams vaistams nustatyti 33141625-7
59 Mikoplazmų identifikacinė sistema Mycoplasma pneumoniae identifikavimo rinkinys 33141625-7
60 Mycoplasma hominis ir Ureaplasma urealyticum identifikavimo diagnostinis rinkinys antigeno nustatymui 33141625-7
61 Mini API identifikavimo plokštelės ir reagentai API Coryne 33141625-7
62 API Listeria 33141625-7
63 API 50 CH 33141625-7
64 API 50 CHB Medium (Bacillus) 33141625-7
65 API 50 CHL Medium (Lactobacterium) 33141625-7
66 ID 32 E 33141625-7
67 ID 32 GN 33141625-7
68 ID 32 STAPH 33141625-7
69 ID 32 C 33141625-7
70 Rapid ID 32 A 33141625-7
71 Rapid ID 32 E 33141625-7
72 Rapid ID 32 STREP 33141625-7
73 ATB G-5 33141625-7
74 ATB BLSE 33141625-7
75 ATB ENTEROC 5 33141625-7
76 ATB PSE 5 33141625-7
77 ATB STREP 5 33141625-7
78 ATB HAEMO 33141625-7
79 ATB ANA 33141625-7
80 ATB FUNGUS 2 INT 33141625-7
81 VP-A + VP-B (1+1) 33141625-7
82 API Suspension medium (2 ml) 33141625-7
83 NIT 1 + NIT 2 (2+2) 33141625-7
84 FB (2amp.) 33141625-7
85 NIN 33141625-7
86 ZYM A 33141625-7
87 ZYM B 33141625-7
88 PYZ 33141625-7
89 Mineralinis aliejus 33141625-7
90 JAMES (2amp.) 33141625-7
91 API Natrio chloridas 0,85% Medium (2 ml) 33141625-7
92 IDENTIFIKACINIAI DISKAI Novobiocinas 5 µg 24496500-2
93 Furazolidonas 100 µg 24496500-2
94 Kolistinas 10 µg 24496500-2
95 Vankomicinas 5 µg 24496500-2
96 Kanamicinas 1000 µg 24496500-2
97 Penicilinas 2 VV 24496500-2
98 SPS diskai 24496500-2
99 Tulžies diskai 24496500-2
100 ANTIMIKROBINIAI PREPARATAI Antibiotikų diskai antimikrobiniam jautrumui nustatyti Ampicilinas 10 µg 24494000-3
101 Ampicilinas/sulbaktamas 20 µg 24494000-3
102 Amoksicilino klavulatas 20/10 µg 24494000-3
103 Amikacinas 30 µg 24494000-3
104 Aztreonamas 30 µg 24494000-3
105 Cefalotinas 30 µg 24494000-3
106 Cefuroksimas 30 µg 24494000-3
107 Cefotaksimas 30 µg 24494000-3
108 Cefoksitinas 30 µg 24494000-3
109 Ceftazidimas 30 µg 24494000-3
110 Cefepimas 30 µg 24494000-3
111 Cefoperazonas 75 µg 24494000-3
112 Ceftriaksonas 30 µg 24494000-3
113 Ciprofloksacinas 1 µg 24494000-3
114 Ciprofloksacinas 5 µg 24494000-3
115 Chloramfenikolis 30 µg 24494000-3
116 Eritromicinas 15 µg 24494000-3
117 Eritromicinas 5 µg 24494000-3
118 Fuzidino rūgštis 10 µg 24494000-3
119 Gentamicinas 10 µg 24494000-3
120 Gentamicinas 120 µg 24494000-3
121 Imipenemas 10 µg 24494000-3
122 Kanamicinas 30 µg 24494000-3
123 Klindamicinas 2 µg 24494000-3
124 Metronidazolis 5 µg 24494000-3
125 Nalidiksinė rūgštis 30 µg 24494000-3
126 Nitrofurantoinas 300 µg 24494000-3
127 Norfloksacinas 10 µg 24494000-3
128 Oksacilinas 1 µg 24494000-3
129 Penicilinas 10 µg 24494000-3
130 Piperacilinas 100 µg 24494000-3
131 Piperacilinas/tazobaktamas 100/10 µg 24494000-3
132 Rifampicinas 5 µg 24494000-3
133 Sulfonamidai 300 µg 24494000-3
134 Streptomicinas 10 µg 24494000-3
135 Tetraciklinas 30 µg 24494000-3
136 Tobramicinas 10 µg 24494000-3
137 Trimetoprimas 5 µg 24494000-3
138 Trimetoprimas/sulfametoksazolis 1,25/23,75 µg 24494000-3
139 Vankomicinas 30 µg 24494000-3
140 Teikoplaninas 30 µg 24494000-3
141 Meropenemas 10 µg 24494000-3
142 Ceftazidimas/Klavulaninė rūgštis 30/10µg 24494000-3
143 Cefotaksimas/Klavulaninė rūgštis 30/10µg 24494000-3
144 Cefpodoksimas/Klavulaninė rūgštis 30/10µg 24494000-3
145 E-testai 24494000-3
146 ANTISERUMAI Haemophilus influenzae antiserumas 24496500-2
147 Neisseriae meningitidis antiserumai 24496500-2
148 Bordetella pertussis antiserumai ir antigenas 24496500-2
149 Shigella antiserumai Polivalentinis agliutinacinis rinkinys šigelėms (A-D)/(poliv.A,A1,B, C1,C2,C3,D) 24496500-2
150 S.dysenteriae tipas 1 24496500-2
151 S.dysenteriae tipas 2 24496500-2
152 S.dysenteriae tipas 3 24496500-2
153 S.dysenteriae tipas 4 24496500-2
154 S.dysenteriae tipas 5 24496500-2
155 S.dysenteriae tipas 6 24496500-2
156 S.dysenteriae tipas 7 24496500-2
157 S.dysenteriae tipas 8 24496500-2
158 S.dysenteriae tipas 9 24496500-2
159 S.dysenteriae tipas 10 24496500-2
160 S.dysenteriae tipas 11 24496500-2
161 S.dysenteriae tipas 12 24496500-2
162 S.boydii tipas 1 24496500-2
163 S.boydii tipas 2 24496500-2
164 S.boydii tipas 3 24496500-2
165 S.boydii tipas 4 24496500-2
166 S.boydii tipas 5 24496500-2
167 S.boydii tipas 6 24496500-2
168 S.boydii tipas 7 24496500-2
169 S.boydii tipas 8 24496500-2
170 S.boydii tipas 9 24496500-2
171 S.boydii tipas 10 24496500-2
172 S.boydii tipas 11 24496500-2
173 S.boydii tipas 12 24496500-2
174 S.boydii tipas 13 24496500-2
175 S.boydii tipas 14 24496500-2
176 S.boydii tipas 15 24496500-2
177 S.boydii tipas 16 24496500-2
178 S.boydii tipas 17 24496500-2
179 S.boydii tipas 18 24496500-2
180 Polivalentinis agliutinacinis serumas S.sonnei 24496500-2
181 Polivalentinis agliutinacinis serumas S.flexneri 24496500-2
182 S.flexneri tipinis agliutinacinis serumas I 24496500-2
183 S.flexneri tipinis agliutinacinis serumas II 24496500-2
184 S.flexneri tipinis agliutinacinis serumas III 24496500-2
185 S.flexneri tipinis agliutinacinis serumas IV 24496500-2
186 S.flexneri tipinis agliutinacinis serumas V 24496500-2
187 S.flexneri tipinis agliutinacinis serumas Vl 24496500-2
188 S.flexneri tipinis grupinis serumas 3,4 24496500-2
189 S.flexneri grupinis serumas 6 24496500-2
190 S.flexneri grupinis agliutinacinis serumas 7,8 24496500-2
191 Yersinia enterocolitica monovalentiniai agliutinaciniai serumai Y.enterocolitica 03 24496500-2
192 Y.enterocolitica 09 24496500-2
193 Y.enterocolitica 05 24496500-2
194 Y.enterocolitica 08 24496500-2
195 Yersinia pseudotuberculosis agliutinaciniai monovalentiniai serumai Y. pseudotuberculosis 01 24496500-2
196 Y.pseudotuberculosis 02 24496500-2
197 Y.pseudotuberculosis 03 24496500-2
198 Y.pseudotuberculosis 04 24496500-2
199 Y.pseudotuberculosis 05 24496500-2
200 Y.pseudotuberculosis 06 24496500-2
201 Escherichia coli antiserumai E.coli nanovalentinis agliutinacinis antiserumas 24496500-2
202 E.coli trivalentis antiserumas I 24496500-2
203 E.coli trivalentis antiserumas II 24496500-2
204 E.coli trivalentis antiserumas III 24496500-2
205 E.coli trivalentis antiserumas IV 24496500-2
206 E.coli monovalentinis antiserumas O111:B4 24496500-2
207 E.coli monovalentinis antiserumas O55:B5 24496500-2
208 E.coli monovalentinis antiserumas O26:B6 24496500-2
209 E.coli monovalentinis antiserumas O86:B7 24496500-2
210 E.coli monovalentinis antiserumas O119:B14 24496500-2
211 E.coli monovalentinis antiserumas O127:B8 24496500-2
212 E.coli monovalentinis antiserumas O125:B15 24496500-2
213 E.coli monovalentinis antiserumas O126:B16 24496500-2
214 E.coli monovalentinis antiserumas O128:B12 24496500-2
215 E.coli monovalentinis antiserumas O114:K90 24496500-2
216 E.coli monovalentinis antiserumas O124:B17 24496500-2
217 E.coli monovalentinis antiserumas O142:K86 24496500-2
218 Escherichia coli O157 antiserumas 24496500-2
219 Salmonella polivalentiniai antiserumai OMA: Grupės A,B,D,E,L (1,2,12+4,5,12+9,12+9,46+3,10+3,15+1,3,19+21) 24496500-2
220 OMB: Grupės C,F,G,H (6,7+6,8+11+13,22+13,23+6,14,24+8,20) 24496500-2
221 HMA (a+b+c+d+i+z10+z29) 24496500-2
222 HMB (e,h+e,n,x+e,n,z15+G) 24496500-2
223 HMC (k+y+L+Z4+r) 24496500-2
224 HMD (z35+z36+z38+z39+z41+z42+z44+z60) 24496500-2
225 HE (e,h+e,n,x+e,n,x15) 24496500-2
226 H1 (1,2+1,5+1,6+1,7+z6) 24496500-2
227 HL (l,v+l,w+l,z13+l,x28+l,z40) 24496500-2
228 HZ4 (z4,z23+z4,z24+z4,z32) 24496500-2
229 HG (f,g+g,p+g,m,s+g,m+m,t) 24496500-2
230 Salmonella agliutinacinis serumas 0:1,2 24496500-2
231 Monovalentinis agliutinacinis serumas Salmonella O:4,5 24496500-2
232 Monovalentinis agliutinacinis serumas Salmonella O:5 24496500-2
233 Monovalentinis serumas Salmonella O:6,7,8 24496500-2
234 Monovalentinis agliutinacinis serumas Salmonella O:7 24496500-2
235 Monovalentinis agliutinacinis serumas Salmonella O:8 24496500-2
236 Monovalentinis agliutinacinis serumas Salmonella O:9 24496500-2
237 Monovalentinis agliutinacinis serumas Salmonella 0:3,10,15 24496500-2
238 Monovalentinis agliutinacinis serumas Salmonella 0:15 24496500-2
239 Salmonella agliutinacinis serumas 0:1,3,19 24496500-2
240 Salmonella agliutinacinis serumas 0:11 24496500-2
241 Salmonella agliutinacinis serumas 0:20 24496500-2
242 Salmonella agliutinacinis serumas 0:13,22,23 24496500-2
243 Salmonella agliutinacinis serumas 0:6,14,24 24496500-2
244 Salmonella agliutinacinis serumas 0:46 24496500-2
245 Salmonella agliutinacinis serumas 0:Vi 24496500-2
246 Monovalentinis serumas Salmonella H-a 24496500-2
247 Monovalentinis serumas Salmonella H-b 24496500-2
248 Monovalentinis serumas Salmonella H-c 24496500-2
249 Monovalentinis serumas Salmonella H-d 24496500-2
250 Monovalentinis serumasSalmonella H -h 24496500-2
251 Monivalentinis serumas Salmonella H-i 24496500-2
252 Monivalentinis serumas Salmonella H-k 24496500-2
253 Monovalentinis serumas Salmonella H-m 24496500-2
254 Monovalentinis serumas Salmonella H-p 24496500-2
255 Monovalentinis serumas Salmonella H-r 24496500-2
256 Monovalentinis serumas Salmonella H-v 24496500-2
257 Monovalentinis serumas Salmonella H-w 24496500-2
258 Monovalentinis serumas Salmonella H-y 24496500-2
259 Monovalentinis serumas Salmonella H-z 24496500-2
260 Monovalentinis serumas Salmonella H-z10 24496500-2
261 Monovalentinis serumas Salmonella H-z15 24496500-2
262 Monovalentinis serumas Salmonella H-x 24496500-2
263 Monovalentinis serumas Salmonella H-f 24496500-2
264 Monovalentinis serumas Salmonella H-s 24496500-2
265 Monovalentinis serumas Salmonella H-t 24496500-2
266 Monovalentinis serumas Salmonella H-u 24496500-2
267 Monovalentinis serumas Salmonella H-q 24496500-2
268 Monovalentinis serumas Salmonella H-2 24496500-2
269 Monovalentinis serumas Salmonella H-5 24496500-2
270 Monovalentinis serumas Salmonella H-6 24496500-2
271 Monovalentinis serumas Salmonella H-7 24496500-2
272 DAŽAI Dažų rinkinys dažymui Gramo būdu 24122400-9
273 Metileno mėlio dažai 24122400-9
274 Dažų rinkinys Corynebacterium diphtheriae dažymui 24122400-9
275 DIAGNOSTIKUMAI IR REAGENTAI MOLEKULINEI BIOLOGIJAI PACE 2 System Chlamydia trachomatis Probe Competition Assay 24496500-2
276 PACE 2 System Chlamydia trachomatis reagentų rinkinys 33124110-9
277 PACE Mėginių surinkimo rinkinys endocervikaliniams mėginiams 33124110-9
278 PACE Mėginių surinkimo rinkinys uretros ir akių junginės mėginiams 33124110-9
279 Detection Reagent PACE 2 24496500-2
280 Fast Express Reagentas 24496500-2
281 HotStart - Taq DNR polimerazė 24496500-2
282 100 bp DNR žymuo 24496500-2
283 2mM dNTP Mix 24496500-2
284 Pradmuo Mycoplasma pneumoniae nustatymui PGR metodu MP1: 5’AAGGACCTGCAAGGGTTCGT 3’ 24496500-2
285 Pradmuo Mycoplasma pneumoniae nustatymui PGR metodu MP2: 5’ CTCTAGCCATTACCTGCTAA 3’ 24496500-2
286 Jaučio serumo albuminas (BSA) 24496500-2
287 Rinkinys genominės DNR išskyrimui 24496500-2
288 Taq DNR polimerazė 24496500-2
289 Vanduo molekulinei biologijai 24496500-2
290 Mycoplasma pneumoniae diagnostinis PGR rinkinys 33124110-9
291 Teigiama Mycoplasma pneumoniae DNR kontrolė 33124110-9
292 Rinkinys GMO kokybinei atrankai PGR metodu 33124110-9
293 LABORATORINĖS PRIEMONĖS Vienkartiniai švirkštai 33141310-6
294 0,2 ml PCR mėgintuvėliai 25240000-5
295 0,5 ml PCR mėgintuvėliai 25240000-5
296 1,5 ml mikrocentrifuginiai mėgintuvėliai 25240000-5
297 2,0 ml mikrocentrifuginiai mėgintuvėliai 25240000-5
298 Mėgintuvėliai polistireniniai 12 x 75 mm 25240000-5
299 Vienkartinės pernešimo pipetės, su rezervuaru pipetės viršuje 25240000-5
300 Pipetės 1 ml 25240000-5
301 Pipetės 10 ml 25240000-5
302 Plastikinės dėžutės kriomėgintuvėliams mikroorganizmų bankui 25240000-5
303 Antgaliai automatinėms pipetėms 0,1-10 µl, su filtru 25240000-5
304 Antgaliai automatinėms pipetėms 0,1-2,5 µl, su filtru 25240000-5
305 Antgaliai automatinėms pipetėms 100 µl, su filtru 25240000-5
306 Antgaliai automatinėms pipetėms 200 µl, su filtru 25240000-5
307 Antgaliai automatinėms pipetėms, 1000µl 25240000-5
308 Antgaliai automatinėms pipetėms, 200µl 25240000-5
309 Antgaliai automatinei "Socorex" pipetei 25240000-5
310 Antgaliai automatinei mini API pipetei "Embouts ATB" 25240000-5
311 Petri lėkštelės 25240000-5
312 Petri lėkštelės 25240000-5
313 Petri lėkštelės 55mm 25240000-5
314 Kontaktinės lėkštelės 25240000-5
315 Aliuminio folija 27521500-8
316 Dezinfektantas stalų ir grindų valymui 24250000-1
317 Stoveliai mėgintuvėliams, metaliniai, stačiakampiai, 50-60vietų 27521500-8
318 Objektiniai stikleliai mikroskopavimui 26152330-0
319 Pludės (Durham vamzdeliai) stikliniai 26152330-0
320 Dengiamieji stikleliai 26152330-0
321 Dengiamieji stikleliai 26152330-0
322 Mėgintuvėliai stikliniai 18 x 180 mm 26152339-3
323 Pirštinės buitinės 25161200-9
324 Polipropileniniai krepšeliai 25240000-5
325 Homogenizavimo maišai 25240000-5
326 Autoklavavimo maišai 25240000-5
327 Anatominiai skalpeliai 33141411-4
328 Dezinfekcinė medžiaga 24250000-1
329 Kilpelės 1 µl 25240000-5
330 Kilpelės 10 µl 25240000-5
331 Klasikinis pleistras 33141112-8
332 Marlė medicininė 33141114-2
333 Membraniniai filtrai 0,22 µm, balti 36712000-5
334 Membraniniai filtrai 0,45 µm, balti 36712000-5
335 Membraniniai filtrai 0,45 µm, pilki 36712000-5
336 Nesterilus tvarstis 33141110-4
337 Pincetai nerūdijančio plieno 33169000-2
338 Pincetai nerūdijančio plieno membraninio filtro paėmimui 33169000-2
339 Vata medicininė, chirurginė 33141115-9
340 Antibiotikų diskų paskirstytojas (dispenseris) 33190000-8
341 Anaerostatas 25240000-5
342 Analitinės šukos gelio elektroforezei,11 dantukų (3x1mm) 25240000-5
343 Laboratorinė stiklinė 26131000-5
344 Vežimėliai instrumentiniai laboratoriniai 33190000-8
345 MITYBINĖS TERPĖS IR JŲ PRIEDAI Noble agaras (Agar Noble) 24641250-6
346 Listerijų agaras (ALOA) su priedu (ALOA)Listerijų agaras Ottaviani ir Agosti 24641250-6
347 (ALOA)Listerijų agaro Ottaviani ir Agosti priedas 24641250-6
348 Baird-Parker terpė su priedu Baird-Parker agaro pagrindas 24641250-6
349 Kiaušinio trynio emulsija su telūritu 24641250-6
350 B.cereus agaras su priedu B. cereus agaro pagrindas 24641250-6
351 B. cereus agaro priedas 24641250-6
352 Kiaušinio trynio emulsija 24641250-6
353 Boltono sultinys su priedu Boltono sultinys 24641250-6
354 Boltono sultinio priedas 24641250-6
355 Brilijantinės žalumos agaras 24641250-6
356 Brilijantinės žalumos tulžies sultinys 2% 24641250-6
357 Buferinis peptono vanduo 24641250-6
358 Jersinijų atranki terpė su priedu CIN - Jersinijų atrankaus agaro pagrindas 24641250-6
359 CIN-Jersinijų atrankus priedas 24641250-6
360 Chromocult Enterobacter sakazakii išskyrimo agaras (ESIA) 24641250-6
361 Czapek agaras 24641250-6
362 Dermasel agaro priedas 24641250-6
363 Dermatofitų tyrimo agaras 24641250-6
364 Dezoksicholato citrato agaras 24641250-6
365 EE sultinys 24641250-6
366 EC sultinys 24641250-6
367 Elek agaras su priedu Elek agaras arba Toksigeniškumo terpė 24641250-6
368 Elek agaro priedas 24641250-6
369 Eugonas LT 24641250-6
370 Izo sensi test agaras 24641250-6
371 Fenolo raudonojo sultinys 24641250-6
372 Fenolo raudonojo manito agaras 24641250-6
373 Listerijų auginimo sultinys su priedu Listerijų Frazerio sultinys 24641250-6
374 Frazerio priedas 24641250-6
375 Geležies sulfito agaras 24641250-6
376 Haemophilus test agaras su priedu Haemophilus test medium base 24641250-6
377 Hemofilų atrankus priedas (HTM) SR0158E 24641250-6
378 Hektoen Enteric agaras 24641250-6
379 Kampilobakterijų atranki terpė su priedu Kampilobakterijų bekraujo atrankaus agaro pagrindas 24641250-6
380 Kampilobakterijų bekraujo atrankaus agaro priedas 24641250-6
381 Kukurūzų miltų agaras 24641250-6
382 Kraujo agaro pagrindas Nr.2 24641250-6
383 Kolumbijos agaras 24641250-6
384 Laurylsulfato sultinys 24641250-6
385 Legionella auginimo terpė su priedais Legionella CYE agaro pagrindas 24641250-6
386 BCYE legionella augimo priedas, beLcisteino 24641250-6
387 BCYE legionella augimo priedas 24641250-6
388 Legionella GVPC priedas selektyvus 24641250-6
389 Leptospirų gausinimo priedas EMJH 24641250-6
390 Listerijų atrankus agaras (OXFORD) su priedu Listerijų atrankaus agaro (OXFORD) pagrindas 24641250-6
391 Listerijų sel. priedas „OXFORD“ 24641250-6
392 Lizino geležies agaras 24641250-6
393 MacConkey agaras 24641250-6
394 MacConkey agaras Nr 3 24641250-6
395 MacConkey agaras su sorbitu 24641250-6
396 MacConkey sultinys 24641250-6
397 Manito druskos agaras 24641250-6
398 Malonato sultinys 24641250-6
399 mEnterokokų agaras (Slanetz Bartley) 24641250-6
400 Mielių ekstrakto agaras vandeniui tirti (Water plate count agar) 24641250-6
401 MRS agaras laktobakterijoms 24641250-6
402 Mueller-Hinton agaras 24641250-6
403 Mueller-Kauffmann tetrationato-novobiocino sultinys su priedu Mueller-Kauffmann tetrationato-novobiocino sultinys 24641250-6
404 Novobiocino atrankus priedas 24641250-6
405 Perfringens TSC terpė su priedu Perfringens agaras 24641250-6
406 Perfringens TSC agaro priedasSR088E 24641250-6
407 Pseudomonų auginimo terpė su priedu Pseudomonų agaras 24641250-6
408 Priedas CN pseudomonų agarui 24641250-6
409 Rappaport-Vassiliadis sultinys 24641250-6
410 Ringerio tabletės 24641250-6
411 Saburo terpė su priedu Saburo gliukozės agaras 24641250-6
412 Chloramfenikolio sel. priedas 24641250-6
413 Saburo sultinys 24641250-6
414 Salyklo ekstrakto agaras 24641250-6
415 Salmonelių-šigelių agaras 24641250-6
416 Simonso citrato agaras 24641250-6
417 Standartinių metodų agaras 24641250-6
418 Standartinių metodų agaras su pienu 24641250-6
419 Streptokokų agaro priedas 24641250-6
420 TBX agaras 24641250-6
421 Tioglikolio sultinys 24641250-6
422 Tergitolio 7 agaras 24641250-6
423 Terpė mikroorganizmų judrumui nustatyti 24641250-6
424 Trijų cukrų geležies agaras 24641250-6
425 Triptono sojos agaras 24641250-6
426 Triptono sojos sultinys 24641250-6
427 Tulžies eskulino azido agaras 24641250-6
428 Violetiniai raudono-tulžies-gliukozės agaras 24641250-6
429 Violetiniai raudono-tulžies-laktozės agaras 24641250-6
430 XLD agaras 24641250-6
431 Anaerobų auginimo terpė su priedu Wilkins-Chalgren anaerobų agaras 24641250-6
432 Wilkins-Chalgren selektyvus priedas anaerobams N-S 24641250-6
433 Wilkins-Chalgren selektyvus priedas anaerobams G-N 24641250-6
434 Arklio serumas sterilus 24641250-6
435 Defibrinuotas arklio kraujas 24641250-6
436 Defibrinuotas avies kraujas 24641250-6
437 Dulcitas 24641250-6
438 FeSO4 x 7H2O 24641250-6
439 Jodo milteliai 24641250-6
440 Kalcio chloridas 24641250-6
441 Kalio hidrofosfatas(K2HPO4) 24641250-6
442 Kalio dihidrofosfatas(KH2PO4) 24641250-6
443 Kalio jodido milteliai 24641250-6
444 NAD-as 24641250-6
445 Natrio dihidrofosfato dihidratas 24641250-6
446 Natrio hidrofosfato dihidratas 24641250-6
447 Polisorbatas 80 (Tween 80) 24641250-6
448 Urea (šlapalas) 24641250-6
449 Urea 40% 24641250-6
450 Chloramfenikolis 24641250-6
451 MEDIKAMENTAI IR VIENKARTINĖS PRIEMONĖS MĖGINIŲ PAĖMIMUI raujo sterilumui paėmimo sistema SIGNAL 33124110-9
452 Kultūretės su Stiuarto terpė mėginių paėmimui 24495000-0
453 Kultūretės su Amies terpe mėginių paėmimui, su anglimi 24495000-0
454 Kultūretė su Cary Blair terpė mėginių paėmimui 24495000-0
455 Tamponai su Dakronu 25240000-5
456 Tamponai plastikiniai su vata 25240000-5
457 Liežuvio prispaudėjai 33190000-8
458 Indeliai šlapimui, sterilūs 25240000-5
459 Indeliai, išmatoms, sterilūs 25240000-5
460 Maišai mėginių paėmimui 1,5 l. talpos 25221000-6
461 Kraujo ėmimo sistemos 25240000-5
462 Adatos 33141320-9
463 Pirštinės vienkartinės nitrilinės S, M, L dydžio 25161200-9
464 Pirštinės vienkartinės lateksinės 25161200-9
465 Buteliai 500 ml 26131000-5
466 Buteliai 1000 ml 26131000-5
467 DIAGNOSTIKUMAI KLINIKINEI-DIAGNOSTIKAI Bendras bilirubinas 33141625-7
468 Skydliaukę stimuliuojantis hormonas (TSH) 33141625-7
469 Prostatos specifinis antigenas(PSA) 33141625-7
470 Chemil. Substratas 33141625-7
471 CI CREAJ 33141625-7
472 CI CHOL2 33141625-7
473 CI LDL 33141625-7
474 CI HDL 33141625-7
475 CI TRIG 33141625-7
476 CI ALTL 33141625-7
477 CI ASTL 33141625-7
478 CI ALP 33141625-7
479 HbA 1C reagentas*24 33141625-7
480 HbA 1C kontrolė 33141625-7
481 PRECINORM U 33141625-7
482 PRECINORM HDL 33141625-7
483 PRECIPATH U 33141625-7
484 CLEAN+CHEK 33141625-7
485 CI UREA 33141625-7
486 STAGO protrombino komplekso aktyvumui nustatyti -SPA 20(12*2) 33141625-7
487 Kiuvetės BE 25240000-5
488 Rutuliukai BE 25240000-5
489 Gama-gliutamiltransferazė 33141625-7
490 Kontrolė CON6 33141625-7
491 KontrolėTumor Marker 33141625-7
492 Probe Wash 33141625-7
493 Probe Cleaning Kit 33141625-7
494 DIAGNOSTIKUMAI IR REAGENTAI PARAZITOLOGIJAI IR SEROLOGIJAI Diagnostiniai rinkiniai bioanalizatoriui "miniVIDAS" Raudonukė IgM 33141625-7
495 Raudonukė IgG 33141625-7
496 CMV IgM 33141625-7
497 CMV IgG 33141625-7
498 Toksoplazmozė IgG 33141625-7
499 Toksoplazmozė IgM 33141625-7
500 Toksoplazmozė IgG avidiškumas 33141625-7
501 Bendras IgE 33141625-7
502 Laimo ligai IgG/M 33141625-7
503 Atipinių pneumonijų ELISA rinkiniai Mycoplasma pneumoniae IgM 33141625-7
504 Mycoplasma pneumoniae IgG 33141625-7
505 Chlamydia pneumoniae IgM 33141625-7
506 Chlamydia pneumoniae IgG 33141625-7
507 B.burgdorferi ELISA diagnostiniai rinkiniai (prie rinkinių turi būti tiekiama išorinė kokybės kontrolė 2 kartams per metus) Laimo liga Borrelia IgG, CSF 33141625-7
508 Laimo liga Borrelia IgM, CSF 33141625-7
509 Laimo liga Borrelia IgG, serume. 33141625-7
510 Laimo liga B. burgdorferi IgM , serume 33141625-7
511 Yersinia enterocolitica rinkiniai Yearsinia enterocolitica IgG 33141625-7
512 Yearsinia enterocolitica IgA 33141625-7
513 Bartonella henselae IIF rinkiniai ir reagentai Bartonella henselae IgM 33141625-7
514 Bartonella henselae IgG 33141625-7
515 Erkinio encefalito rinkiniai Erkinio encefalito virusas IgM 33141625-7
516 Erkinio encefalito virusas IgG 33141625-7
517 Epštein Baro viruso rinkiniai Epštein-Baro virusas IgM (imunoblotas) 33141625-7
518 Epštein-Baro virusas IgG (imunoblotas) 33141625-7
519 Difterija IgG 33141625-7
520 Kokliušo diagnostikos rinkiniai Bordetella pertusis IgM 33141625-7
521 Bordetella pertusis IgG 33141625-7
522 Helmintozių (trichineliozės, toksokarozės, cisticerkozės) diagnostiniai rinkiniai. Turi būti vieno gamintojo Trichineliozė IgG 33141625-7
523 Toksokorozė IgG 33141625-7
524 Cisticerkozė IgG 33141625-7
525 Echinokokozės diagnostiniai rinkiniai Ech. Granulosus IgG 33141625-7
526 Ech. multilocularis IgG 33141625-7
527 Western blotas echinokokozei IgG 33141625-7
528 Vidurių šiltinės antigenas 33141625-7
529 Pirmuonių antigenų išmatose nustatymo rinkiniai Entamoeba histolytica antigeno nustatymas 33141625-7
530 Kriptosporidijų antigenui nustatyti 33141625-7
531 Giardia lamblia antigenui nustatyti 33141625-7
532 Entamoeba histolytica IgG 33141625-7
533 Rinkinys žarnyno parazitų diagnostikai formalino-etilacetato sedimentacijos metodu 33141625-7
534 Dažai pirmuonių oocistoms nustatyti išmatose 33141625-7
535 Reagentai Vandenilio peroksidas 24111100-6
536 Kalio jodidas 24147000-6
537 Natrio šarmas 24147000-6
538 Tween 20 24147000-6
539 Na2 CO3 24133310-1
540 NaHCO3 24133320-4
541 PBS 24133000-5
542 Absoliutus etanolis 24142220-9
543 Jaučio hemoglobinas (Bovine hemoglobin) 24147000-6
544 Substrato PNPP tirpalas 33141625-7
545 Cinko sulfatas 24133120-2
546 Objetiniai stikliukai 26152330-0
547 Objetiniai stikliukai 26152330-0
548 Dengiamieji stikliukai 26152330-0
549 Dengiamieji stikliukai 26152330-0
550 Dengiamieji stikliukai 26152330-0
551 Mėgintuvėliai 25200000-3
552 Mėgintuvėlia 26152339-3
553 Plastikinės dėžutės serumų bankui 25200000-3
554 Mėgintuvėliai 26152339-3
555 Piltuvėliai 26152330-0
556 Cilindrai 26152330-0
557 Cilindrai 26152330-0
558 Antgaliai automatinei pipetei 1 ml 25240000-5
559 Antgaliai elektroninei pipetei 25240000-5
560 Antgaliai elektroninei pipetei 25240000-5
561 Antgaliai automatinei pipetei 25240000-5
562 Antgaliai elektroninei pipetei 25240000-5
563 Spiritinė lemputė 26152330-0
564 Stiklinis indelis dažymui 26152330-0
565 Pipete plastikinė 3 ml graduota 25200000-3
566 LABORATORINĖS PRIEMONĖS IR REAGENTAI CHEMIJOS LABORATORIJAI Guminė kriaušė 25171000-0
567 Matavimo kolba (stiklinė), talpa 50 ml su plastikiniu kamščiu 26152330-0
568 Vienkartiniai svėrimo indeliai 36731000-4
569 Pipetė stiklinė graduota 5 ml 26152330-0
570 Pipetė stiklinė graduota 10 ml 26152330-0
571 Matavimo kolba (stiklinė), talpa 250 ml su plastikiniu kamščiu 26152330-0
572 Matavimo kolba (stiklinė), talpa 200 ml su plastikiniu kamščiu 26152330-0
573 Filtras membraninis 36712000-5
574 Filtro popierius 36712000-5
575 Filtro popierius 36712000-5
576 Filtro popierius 36712000-5
577 Stiklinė 26152330-0
578 Silikoniniai vamzdeliai (išorinis diametras d=1 cm, vidinis d=0,5 cm, ilgis 5 m) 36712200-7
579 Sorbciniai vamzdeliai ST-212 (СТ-212) 26152330-0
580 Buteliukai 36731000-4
581 Tarpinės tefloninės 36731000-4
582 Antgaliai,1 ml talpos, vienkartiniai plastikiniai 36731000-4
583 Antgaliai, 200 µl talpos , vienkartiniai plastikiniai 36731000-4
584 Matavimo kolba, stiklinė su šlifiniu kamšteliu 26152330-0
585 Šlifinis kamštis 26152330-0
586 Mėgintuvėlis, graduotas ,stiklinis su šlifiniu kamščiu 26152330-0
587 Kolba, plokščiadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
588 Stovas mėgintuvėliams 25223200-2
589 Stovas mėgintuvėliams 25223200-2
590 Laboratorinė plėvelė Parafilm „M“ 36731000-4
591 Mėgintuvėlis,centrifuginis, plastikinis 25223200-2
592 Mėgintuvėlis,centrifuginis, plastikinis 25223200-2
593 Kaištukai silikoniniams vamzdeliams (žarnoms) 26152330-0
594 Mikrošpateliai (mentelės birioms medžiagoms) 27140000-8
595 Špateliai (mentelės birioms medžiagoms) 27140000-8
596 Svėrimo piltuvėliai 26152330-0
597 Svėrimo piltuvėliai 26152330-0
598 Ferulės 36712200-7
599 Ferulės 36712200-7
600 Ferulės 36712200-7
601 Lainerio tvirtinimo tarpinės (O-ring) 36712200-7
602 Lainerio tvirtinimo tarpinės (O-ring) 36712200-7
603 Filtras membraninis 36712000-5
604 Filtras membraninis 36712000-5
605 Vienkartinis švirkštas 33141310-6
606 Kolba, erlenmejerio, su šlifu ir stikliniu kamščiu 26152330-0
607 Užsukami stikliniai buteliukai 36731000-4
608 Užsukami balti kamšteliai 36731000-4
609 Tarpinės kamšteliams 36731000-4
610 Kolba, erlenmejerio 26152330-0
611 Sugėrėjas su poringomis plokštelėmis 26152330-0
612 Kolba, erlenmejerio, su šlifu ir stikliniu kamščiu 26152330-0
613 Cilindras, matavimo, stiklinis, su stikliniu pagrindu 26152330-0
614 Lėkštelė, porcelianinė 26241300-2
615 1,10-fenantrolino chlorido monohidratas 24132120-5
616 4-aminoantipirinas 24144100-6
617 4-dimetilamino benzaldehidas 24144100-6
618 4-fluorfenolis 24142400-5
619 Acetonas 24146200-1
620 Acetonas 24146200-1
621 Acetonitrilas 24142000-1
622 Acetonitrilas 24142000-1
623 Acto rūgštis 24143210-3
624 Acto rūgštis (ledinė) 24143210-3
625 Acto rūgštis 24143210-3
626 Amoniakas 24151300-0
627 Amonio acetatas 24147000-6
628 Amonio chloridas 24132120-5
629 Amonio karbonatas, (NH4)2CO3 24133300-8
630 Amonio molibdatas, tetrahidratas (NH4)6Mo7O24´4H2O 24135000-9
631 Amonio sulfatas 24135000-9
632 Askorbo rūgštis 24143200-0
633 Azoto rūgštis 24151100-8
634 Azoto rūgštis 24151100-8
635 Barbitūrinė rūgštis (C4H4N2O3) 24143200-0
636 Bario chloridas, dihidratas 24132120-5
637 CDTA (trans-1,2-diaminociklo heksan - N,N,N’,N’-tetracto rūgšties monohidratas) 24144100-6
638 Cezio chloridas 24132120-5
639 Chloraminas-T (C7H7ClNNaO2S×3H2O) 24144100-6
640 Cikloheksanas 24141120-1
641 Cinko acetatas, dihidratas 24147000-6
642 Citrinos rūgštis (C8H8O7∙H2O) 24143200-0
643 Dichlormetanas 24141300-7
644 Dietileteris 24146320-8
645 Druskos rūgštis 24131470-6
646 EDTA Dinatrio magnio (C10H12N2O8Na2Mg) 24147000-6
647 Elektrolito tirpalas KCl-AgCl 24135000-9
648 Elektros laidžio stand.tirpalas 1,413 µs/cm 24135000-9
649 EPA 610-N Polynuclear Aromatic Hydrocarbon Kit: Acenaftenas – 5 g, Acenaftilenas - 0,1 g, Antracenas – 5 g, Benzo(a)antracenas – 0,1 g, Benzo(a)pirenas – 0,1 g, Benz(k)fluorantenas – 0,05 g, Benzo-ghi-perilenas– 0,025 g, Benz(k)fluorantenas – 0,05 g, Chryzenas (93%) – 0,1 g, Dibenzo(a,h)antracenas – 0,1 g, Fluorantenas – 5g, Fluorenas – 5 g, ndeno(1,2,3-cd)pirenas 0,01 g, Naftalenas – 5g, Fenantrenas – 5g, Pirenas – 5g 24147000-6
650 Etaloninė medžiaga 1,2-Dichloretanas 24141300-7
651 Etaloninė medžiaga 4,4-DDE 24210000-9
652 Etaloninė medžiaga 4,4-DDT 24210000-9
653 Etaloninė medžiaga Atrazinas 24210000-9
654 Etaloninė medžiaga Azinofos - metilas 24210000-9
655 Etaloninė medžiaga Benzenas 24141221-9
656 Etaloninė medžiaga Bromdichlormetanas 24141300-7
657 Etaloninė medžiaga Bromoformas 24141300-7
658 Etaloninė medžiaga Cianazinas 24210000-9
659 Etaloninė medžiaga Cipermetinas 24210000-9
660 Etaloninė medžiaga Dimetachloras 24210000-9
661 Etaloninė medžiaga Flutriafolas 24210000-9
662 Etaloninė medžiaga Folpetas 24210000-9
663 Etaloninė medžiaga Kaptanas 24210000-9
664 Etaloninė medžiaga Lindanas 24210000-9
665 Etaloninė medžiaga Oksadilisilas 24210000-9
666 Etaloninė medžiaga Pirimifosas 24210000-9
667 Etaloninė medžiaga Pirimikarbas 24210000-9
668 Etaloninė medžiaga Simazinas 24210000-9
669 Etaloninė medžiaga Triadimenolas 24210000-9
670 Etaloninė medžiaga α - endosulfanas 24210000-9
671 Etaloninė medžiaga α - Heksachlorcikloheksanas (α – HCH) 24210000-9
672 Etaloninė medžiaga β-endosulfanas 24210000-9
673 Etaloninė medžiaga β-Heksachlorcikloheksanas (β – HCH) 24210000-9
674 Etaloninė medžiaga δ-Heksachlorcikloheksanas (δ – HCH) 24210000-9
675 Etilenglikolis 24142310-7
676 Florizilis 24135000-9
677 Geležies trichloridas,heksahidratas FeCl3´6H2O 24132120-5
678 Gintaro rūgštis (C4H6O4) 24143200-0
679 Gyvsidabrio (II) sulfatas, HgSO4 24131000-1
680 Griso reagentas 24147000-6
681 Hidroksilamino hidrochloridas (NH2OH.HCl) 24144100-6
682 Izooktanas 24141000-4
683 Kalcio chloridas, granulės 24132120-5
684 Kalcio karbonatas 24133300-8
685 Kalibracinis standartinis naftos produktų mišinys 24147000-6
686 Kalio bichromatas 24134200-4
687 Kalio chromatas (K2CrO4) 24134200-4
688 Kalio heksachlorplatinatas 24135000-9
689 Kalio heksaciano feratas (III), trihidratas 24135000-9
690 Kalio hidrogenftalatas (C8KO4H5) 24144200-7
691 Kalio jodidas, KI 24135000-9
692 Kalio nitratas 24151100-8
693 Kalio permanganatas KMnO4 24134100-3
694 Kalio persulfatas (K2S2O8) 24133120-2
695 Kalio stibio tartratas 24147000-6
696 Kalio-natrio tartratas (KNaC4H4O6.4H2O) 24147000-6
697 Kjeldalio tabletės 24135000-9
698 Kobalto (II) chloridas, heksahidratas 24132120-5
699 Krakmolas 24147000-6
700 Ksilolas 24141224-0
701 Lantano oksidas 24121000-8
702 Magnio acetatas×4H2O 24147000-6
703 Magnio modifikatorius AAS grafitinei krosniai 24135000-9
704 Metanolis 24142210-6
705 Metanolis 24142210-6
706 Metilo raudonas 24122400-9
707 Multielementinis metalų tirpalas 24135000-9
708 N-(1-naftil)-1,2-diaminoetandihidrochloridas (C10H7NHCH2CH2NH2•2HCl) 24147000-6
709 Natrio borohidridas 24131130-1
710 Natrio chloridas 24132120-5
711 Natrio dichloroizocianourato dihidratas (C3N3O3Cl2Na×2H2O) 24147000-6
712 Natrio hidro karbonatas 24133320-4
713 Natrio hidroksidas 24131520-2
714 Natrio hidroksidas, fiksanalis 24131522-6
715 Natrio molibdatas Na2MoO4 ×2H2O 24134000-2
716 Natrio molibdatas Na2MoO4 ×2H2O 24134000-2
717 Natrio nitritas 24134000-2
718 Natrio salicilatas (C7H5NaO3) 24147000-6
719 Natrio silicio fluoridas, Na2SiF6 24135000-9
720 Natrio sulfatas bevandenis 24133124-0
721 Natrio sulfatas, bevandenis 24133124-0
722 Natrio tetraboratas, Na2B4O7∙10H2O 24135200-1
723 Neslerio reagentas 24147000-6
724 n-heksanas 24141000-4
725 n-heksanas 24141000-4
726 n-propanolis 24132200-0
727 Ortofosforo rūgštis 24131420-1
728 Paladžio modifikatorius AAS grafitinei krosniai 24135000-9
729 Paliudyta pamatinė medžiaga (Trace elements in wholemeal flour) 24135000-9
730 Perchloro rūgštis 24132200-0
731 Propanolis-2 24142500-6
732 Reagentų rinkinys ECD detektoriaus patikrinimui 24147000-6
733 Reagentų rinkinys FID detektoriaus patikrinimui 24147000-6
734 Reagentų rinkinys NPD detektoriaus patikrinimui 24147000-6
735 Salicilo rūgštis 24143200-0
736 Sidabro nitratas, AgNO3 24151100-8
737 Sieros rūgštis 24131411-5
738 Standartinis Amonio NH4+ tirpalas 24135000-9
739 Standartinis Chlorido tirpalas 24135000-9
740 Standartinis chromo (VI) tirpalas 24135000-9
741 Standartinis Druskos rūgšties tirpalas 24135000-9
742 Standartinis fosfato tirpalas 24135000-9
743 Standartinis geležies tirpalas 24135000-9
744 Standartinis jodo tirpalas 24135000-9
745 Standartinis Kalio permanganato tirpalas 24135000-9
746 Standartinis natrio oksalato tirpalas 24135000-9
747 Standartinis natrio tiosulfato tirpalas 24135000-9
748 Standartinis nitrato tirpalas 24135000-9
749 Standartinis Sidabro nitrato tirpalas 24135000-9
750 Standartinis sieros rūgšties tirpalas 24131411-5
751 Standartinis tirpalas Poliaromatiniams angliavandeniliams nustatyti: Supelco TCL Polynuclear aromatic hydrocarbons Mix, Catalog No. 49156 MIX 24147000-6
752 Sulfamo rūgštis 24143200-0
753 Sulfanilamidas (NH2C6H4SO2NH2) (arba 4-aminobenzensulfamido) 24144100-6
754 Tetrahidrofuranas 24147000-6
755 Tirpalų komplektas deguonies daviklio StirrOx priežiūrai 24135000-9
756 Trilonas B 24147000-6
757 Trinatrio citrato dihidratas (C6H5O7Na3×2H2O) 24147000-6
758 Vandenilio peroksidas 24135300-2
759 Vidinis elektrodo R502 užpildymo tirpalas 1mol/l KNO3 24135000-9


IV. PIRKIMO BŪDAS

1. PIRKIMO BŪDO PAVADINIMAS
Supaprastintas atviras konkursas 

3. ANKSTESNIO PIRKIMO, DĖL KURIO PASIRINKTAS SKELBIAMŲ DERYBŲ, NESKELBIAMŲ DERYBŲ BŪDAS, SUPAPRASTINTŲ PIRKIMŲ ATVEJAIS, KAI APIE PIRKIMĄ NEBUVO SKELBTA, PIRKIMO NUMERIS (-IAI)
 

4. AR PIRKIMAS ATLIEKAMAS TAIKANT DINAMINĘ PIRKIMŲ SISTEMĄ?   TAIP          NE     
V. VOKŲ SU PASIŪLYMAIS ATPLĖŠIMO PROCEDŪRA
1. Vokų su pasiūlymais (orientaciniais pasiūlymais) atplėšimo data ir laikas arba pasiūlymų pateikimo termino pabaigos data ir laikas (supaprastintų pirkimų atveju, jeigu nevykdoma vokų su pasiūlymais atlpėšimo procedūra)
2007-05-29    10:00 
VI. PIRKIMO PRADŽIA
1. IŠANKSTINIAI SKELBIMAI APIE PIRKIMĄ
     1.1. skelbimo išsiuntimo iš Viešųjų pirkimų tarnybos data
 
     1.2. skelbimo paskelbimo Centrinėje viešųjų pirkimų informacinėje sistemoje data
(pildyti, jei skelbta nurodytoje sistemoje)
 
     1.3. skelbimo paskelbimo Europos Bendrijos oficialiame leidinyje data
(pildyti, jeigu skelbtas tarptautinis skelbimas)
 
2. SKELBIMAI APIE PIRKIMĄ
     2.1. skelbimo išsiuntimo iš Viešųjų pirkimų tarnybos data
2007-05-08 
     2.2. skelbimo paskelbimo Centrinėje viešųjų pirkimų informacinėje sistemoje data
(pildyti, jei skelbta nurodytoje sistemoje)
 
     2.3. skelbimo paskelbimo Europos Bendrijos oficialiame leidinyje data
(pildyti, jeigu skelbtas tarptautinis skelbimas)
2007-05-11 
3. SUPAPRASTINTI SKELBIMAI APIE PIRKIMĄ DINAMINĖJE PIRKIMŲ SISTEMOJE
     3.1. skelbimo išsiuntimo iš Viešųjų pirkimų tarnybos data
 
     3.2. skelbimo paskelbimo Centrinėje viešųjų pirkimų informacinėje sistemoje data
(pildyti, jei skelbta nurodytoje sistemoje)
 
     3.3. skelbimo paskelbimo Europos Bendrijos oficialiame leidinyje data
(pildyti, jeigu skelbtas tarptautinis skelbimas)
 

4. TAIS ATVEJAIS, KAI BUVO SKELBTAS PRANEŠIMAS DĖL SAVANORIŠKO EX ANTE SKAIDRUMO IR/ARBA
SUPAPRASTINTŲ PIRKIMŲ ATVEJU, JEIGU BUVO SKELBTAS INFORMACINIS PRANEŠIMAS APIE SPRENDIMĄ PIRKTI PREKES,
PASLAUGAS AR DARBUS NEPASKELBUS APIE PIRKIMĄ
     4.1. informacinio pranešimo/ pranešimo dėl savanoriško ex ante skaidrumo paskelbimo Centrinėje viešųjų pirkimų informacinėje sistemoje data (pildyti, jeigu skelbta nurodytoje sistemoje)
 
     4.2. pranešimo dėl savanoriško ex ante skaidrumo paskelbimo Europos Bendrijų oficialiame leidinyje data
 
5. KVIETIMO PATEIKTI PASIŪLYMUS DATA (pildyti, tik jeigu buvo atliktas pirkimas neskelbiamų derybų būdu ar supaprastintų pirkimų atvejais, kai apie pirkimą neskelbiama)
 
VII. DALYVIAI (KANDIDATAI)
Pavadinimas Kodas Adresas Šalis
L. R. Tamulio firma "Meditalika" 134565744  Kęstučio g. 57-13, Kaunas  Lietuva 
Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras 122889222  Mokslininkų g. 11, LT-08412 Vilnius  Lietuva 
A. Tamošiūno įmonė 147316390  Marijonų g. 45, Panevėžio m., LT-35125 Panevėžio m. sav.  Lietuva 
O. Žuravliovo įmonė "AVSISTA" 155525379  Žirmūnų g.139, Vilnius  Lietuva 
UAB 'Interlux' 110608112  Aviečių g. 16, LT-08418, Vilnius  Lietuva 
UAB "Roche Lietuva" 300089404  J. Jasinskio g. 16A, Vilniaus m., Vilniaus m. sav.  Lietuva 
Uždaroji akcinė bendrovė "BIOMETRIJA" 123221635  Rygos g. 15, LT-05245 Vilnius  Lietuva 
Uždaroji akcinė bendrovė "LABOCHEMA" 124255779  Vilkpėdės g.22, LT-03151 Vilnius  Lietuva 
UAB "Diagnostinės sistemos" 122263421  P. Smuglevičiaus g. 1, LT-08311 Vilnius  Lietuva 
Uždaroji akcinė bendrovė "SUVA" 121952584  Savanorių pr. 180-54, Vilniaus m., 01354 Vilniaus m. sav.  Lietuva 
A. Zapalskio IĮ "Azas" 147838431  Beržų g. 10, Panevėžio m., LT-36233 Panevėžio m. sav.  Lietuva 
Uždaroji akcinė bendrovė "GENERIX" 122752661  Šeimyniškių g. 14-1, Vilniaus m., 2005 Vilniaus m. sav.  Lietuva 
UAB "Oriola–Vilnius" 111472747  Laisvės pr. 75, LT-06144 Vilnius  Lietuva 
Uždaroji akcinė bendrovė "LOKMIS" 123011245  Naugarduko g. 68B, Vilniaus m., Vilniaus m. sav.  Lietuva 
Uždaroji akcinė bendrovė "LABMED" 111475280  Buivydiškių g. 10, Vilnius  Lietuva 
UAB "DIAMEDICA" 111768155  Buivydiškių g.10, Vilnius  Lietuva 
Uždaroji akcinė bendrovė "ARDEOLA" 221731170  Sabaniausko g.14, Vilnius  Lietuva 
UAB "BIOTECHA" 300630105  Antakalnio g. 36, Vilnius  Lietuva 
UAB 'Linea libera' 122145775  Akademijos g. 2, 08412 Vilnius  Lietuva 
UAB "Siemens Medical Solutions Diagnostics" 111645576  S. Žukausko g. 23, Vilniaus m., Vilniaus m. sav.  Lietuva 
Uždaroji akcinė bendrovė "Bioeksma" 300096612  Mokslininkų g. 11, Vilniaus m., Vilniaus m. sav.  Lietuva 
UAB 'Genomas' 145012392  Panerių g. 51-222, Vilnius  Lietuva 


VIII. PASIŪLYMŲ VERTINIMAS
1. PASIŪLYMŲ VERTINIMO KRITERIJAI
Ekonomiškai naudingiausio pasiūlymo
Mažiausios kainos
Skirtingoms pirkimo objekto dalims taikomi skirtingi vertinimo kriterijai (detalizuoti žemiau esančioje lentelėje)
Vertinimo kriterijus Pirkimo objekto dalies (-ių) numeris (-iai)
Ekonomiškai naudingiausio pasiūlymo  
Mažiausios kainos  

Pirkimo objekto dalies (-ių) numeris (-iai) Kandidato pavadinimas
     

3. ATMESTI PASIŪLYMAI (GALUTINIAI PASIŪLYMAI)
Pirkimo objekto dalies (-ių) numeris (-iai) Dalyvio pavadinimas Pasiūlymo atmetimo teisiniai pagrindai Atmetimo priežastys Pasiūlymo kaina (Lt) Pasiūlymo kainos išraiška
           

4. SPRENDIMAS SUDARYTI SUTARTĮ IR INFORMAVIMAS
4.1. Sudaryta pasiūlymų eilė arba priimtas sprendimas dėl laimėjusio pasiūlymo (jei pasiūlymą pateikti kviečiamas vienas tiekėjas arba gautas vienas pasiūlymas)
Pirkimo objekto dalies numeris Patvirtintos/sudarytos pasiūlymų eilės numeris Dalyvio pavadinimas Pasiūlymo (pasiūlymo dalies) ekonominis naudingumas Pasiūlymo (pasiūlymo dalies) kaina Pasiūlymo (pasiūlymo dalies) kainos išraiška
 2  1   UAB 'Linea libera'   1.956,15   
 2  2   Uždaroji akcinė bendrovė "ARDEOLA"   3.540,00   
 3  1   UAB 'Linea libera'   3.912,30   
 3  2   Uždaroji akcinė bendrovė "ARDEOLA"   7.080,00   
 4  1   UAB 'Linea libera'   1.956,15   
 5  1   UAB 'Linea libera'   532,35   
 5  2   UAB "Diagnostinės sistemos"   630,00   
 5  3   UAB 'Interlux'   941,22   
 5  4   UAB "DIAMEDICA"   963,90   
 5  5   Uždaroji akcinė bendrovė "ARDEOLA"   504,00   
 6  1   UAB "DIAMEDICA"   583,80   
 6  2   UAB 'Linea libera'   675,15   
 6  3   UAB 'Interlux'   861,00   
 7  1   UAB 'Interlux'   657,72   
 7  2   UAB "DIAMEDICA"   840,00   
 7  3   UAB "Diagnostinės sistemos"   1.260,00   
 8  1   UAB "Diagnostinės sistemos"   483,00   
 8  2   UAB 'Interlux'   737,74   
 8  3   UAB 'Linea libera'   821,28   
 9  1   UAB "DIAMEDICA"   1.322,00   
 9  2   UAB "Diagnostinės sistemos"   1.365,25   
 9  3   Uždaroji akcinė bendrovė "ARDEOLA"   1.512,00   
 9  4   UAB 'Linea libera'   1.659,00   
 9  5   UAB 'Interlux'   1.932,00   
 10  1   UAB "DIAMEDICA"   326,55   
 10  2   UAB 'Linea libera'   502,95   
 10  3   UAB "Diagnostinės sistemos"   903,00   
 11  1   UAB "Oriola–Vilnius"   7.339,50   
 12  1   UAB 'Interlux'   262,50   
 12  2   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   441,00   
 13  1   UAB 'Linea libera'   502,95   
 13  2   UAB "Diagnostinės sistemos"   1.207,50   
 14  1   UAB 'Genomas'   252,00   
 14  2   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   294,00   
 14  3   UAB 'Interlux'   315,00   
 15  1   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   275,63   
 17  1   UAB "DIAMEDICA"   1.953,00   
 17  2   Uždaroji akcinė bendrovė "ARDEOLA"   2.598,44   
 17  3   UAB 'Linea libera'   3.339,00   
 18  1   UAB "DIAMEDICA"   210,00   
 18  2   Uždaroji akcinė bendrovė "ARDEOLA"   245,72   
 18  3   UAB 'Linea libera'   420,00   
 19  1   UAB 'Interlux'   2.543,10   
 19  2   Uždaroji akcinė bendrovė "ARDEOLA"   3.858,75   
 19  3   Uždaroji akcinė bendrovė "Bioeksma"   6.844,00   
 19  4   UAB "Diagnostinės sistemos"   6.982,50   
 19  5   Uždaroji akcinė bendrovė "BIOMETRIJA"   8.053,50   
 20  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   540,02   
 20  2   Uždaroji akcinė bendrovė "ARDEOLA"   963,90   
 20  3   Uždaroji akcinė bendrovė "Bioeksma"   1.163,48   
 20  4   UAB "DIAMEDICA"   1.260,00   
 20  5   UAB 'Interlux'   1.764,00   
 21  1   UAB 'Interlux'   411,60   
 21  2   UAB "Diagnostinės sistemos"   849,60   
 22  1   UAB 'Interlux'   1.646,40   
 22  2   UAB "Diagnostinės sistemos"   2.940,00   
 22  3   UAB "DIAMEDICA"   5.527,20   
 23  1   UAB 'Interlux'   154,35   
 23  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   159,30   
 23  3   UAB 'Linea libera'   346,50   
 23  4   Uždaroji akcinė bendrovė "ARDEOLA"   472,50   
 23  5   Uždaroji akcinė bendrovė "LABOCHEMA"   672,60   
 23  6   UAB "DIAMEDICA"   2.583,00   
 24  1   UAB 'Interlux'   154,35   
 24  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   159,30   
 24  3   UAB 'Linea libera'   346,50   
 24  4   Uždaroji akcinė bendrovė "ARDEOLA"   472,50   
 24  5   Uždaroji akcinė bendrovė "LABOCHEMA"   672,60   
 24  6   UAB "DIAMEDICA"   740,25   
 26  1   UAB "Diagnostinės sistemos"   519,20   
 27  1   UAB 'Interlux'   10,29   
 27  2   Uždaroji akcinė bendrovė "ARDEOLA"   21,00   
 27  3   UAB 'Linea libera'   25,96   
 27  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   91,88   
 27  5   Uždaroji akcinė bendrovė "LABOCHEMA"   44,84   
 27  6   UAB "DIAMEDICA"   126,00   
 28  1   Uždaroji akcinė bendrovė "LABOCHEMA"   36,76   
 28  2   UAB 'Interlux'   58,53   
 29  1   Uždaroji akcinė bendrovė "LABOCHEMA"   78,94   
 29  2   UAB 'Interlux'   117,06   
 30  1   Uždaroji akcinė bendrovė "LABOCHEMA"   78,94   
 30  2   UAB 'Interlux'   117,06   
 31  1   Uždaroji akcinė bendrovė "LABOCHEMA"   42,19   
 32  1   Uždaroji akcinė bendrovė "LABOCHEMA"   76,94   
 32  2   UAB 'Interlux'   117,06   
 33  1   UAB 'Interlux'   117,60   
 33  2   UAB "Diagnostinės sistemos"   212,40   
 34  1   UAB 'Interlux'   239,40   
 34  2   UAB "Diagnostinės sistemos"   424,80   
 37  1   Uždaroji akcinė bendrovė "Bioeksma"   42,48   
 37  2   UAB 'Interlux'   81,30   
 39  1   Uždaroji akcinė bendrovė "Bioeksma"   36,58   
 41  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   57,82   
 41  2   UAB 'Interlux'   104,90   
 41  3   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   53,10   
 41  4   Uždaroji akcinė bendrovė "Bioeksma"   54,28   
 42  1   UAB 'Interlux'   566,40   
 42  2   L. R. Tamulio firma "Meditalika"   767,00   
 42  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   932,20   
 43  1   L. R. Tamulio firma "Meditalika"   944,00   
 43  2   UAB 'Interlux'   1.132,80   
 43  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.156,40   
 44  1   UAB 'Linea libera'   92,40   
 44  2   UAB 'Interlux'   142,80   
 44  3   Uždaroji akcinė bendrovė "LABOCHEMA"   169,92   
 44  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   174,93   
 45  1   UAB 'Linea libera'   92,40   
 45  2   UAB 'Interlux'   142,80   
 45  3   Uždaroji akcinė bendrovė "LABOCHEMA"   169,92   
 45  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   192,36   
 46  1   UAB 'Linea libera'   92,40   
 46  2   UAB 'Interlux'   142,80   
 46  3   Uždaroji akcinė bendrovė "LABOCHEMA"   162,84   
 46  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   0,00   
 47  1   UAB 'Linea libera'   4.568,96   
 47  2   UAB "DIAMEDICA"   3.927,00   
 48  1   UAB "DIAMEDICA"   2.435,52   
 48  2   UAB 'Linea libera'   2.483,25   
 49  1   UAB 'Linea libera'   2.677,50   
 49  2   UAB "DIAMEDICA"   3.530,56   
 50  1   UAB "DIAMEDICA"   1.221,30   
 50  2   UAB 'Linea libera'   1.328,25   
 51  1   UAB 'Linea libera'   504,00   
 51  2   UAB "DIAMEDICA"   719,80   
 52  1   UAB 'Linea libera'   336,00   
 53  1   UAB "Diagnostinės sistemos"   504,00   
 53  2   UAB "DIAMEDICA"   714,00   
 54  1   UAB "Diagnostinės sistemos"   75,60   
 55  1   UAB "Diagnostinės sistemos"   25,20   
 56  1   UAB "Diagnostinės sistemos"   37,80   
 57  1   UAB "Diagnostinės sistemos"   44,10   
 58  1   UAB "Diagnostinės sistemos"   3.990,00   
 58  2   Uždaroji akcinė bendrovė "ARDEOLA"   4.095,00   
 58  3   UAB "DIAMEDICA"   4.200,00   
 59  1   UAB "DIAMEDICA"   1.062,00   
 59  2   UAB "Diagnostinės sistemos"   2.352,00   
 60  1   UAB "DIAMEDICA"   3.519,60   
 60  2   UAB "Diagnostinės sistemos"   4.074,00   
 61  1   UAB "DIAMEDICA"   630,00   
 62  1   UAB "DIAMEDICA"   630,00   
 63  1   UAB "DIAMEDICA"   210,00   
 64  1   UAB "DIAMEDICA"   210,00   
 65  1   UAB "DIAMEDICA"   210,00   
 66  1   UAB "DIAMEDICA"   1.260,00   
 67  1   UAB "DIAMEDICA"   4.200,00   
 68  1   UAB "DIAMEDICA"   1.680,00   
 69  1   UAB "DIAMEDICA"   1.680,00   
 70  1   UAB "DIAMEDICA"   1.680,00   
 71  1   UAB "DIAMEDICA"   630,00   
 72  1   UAB "DIAMEDICA"   1.680,00   
 73  1   UAB "DIAMEDICA"   315,00   
 74  1   UAB "DIAMEDICA"   330,75   
 75  1   UAB "DIAMEDICA"   315,00   
 76  1   UAB "DIAMEDICA"   315,00   
 77  1   UAB "DIAMEDICA"   840,00   
 78  1   UAB "DIAMEDICA"   315,00   
 79  1   UAB "DIAMEDICA"   2.100,00   
 80  1   UAB "DIAMEDICA"   1.680,00   
 81  1   UAB "DIAMEDICA"   252,00   
 82  1   UAB "DIAMEDICA"   3.675,00   
 83  1   UAB "DIAMEDICA"   504,00   
 84  1   UAB "DIAMEDICA"   630,00   
 85  1   UAB "DIAMEDICA"   126,00   
 86  1   UAB "DIAMEDICA"   252,00   
 87  1   UAB "DIAMEDICA"   252,00   
 88  1   UAB "DIAMEDICA"   126,00   
 89  1   UAB "DIAMEDICA"   504,00   
 90  1   UAB "DIAMEDICA"   126,00   
 91  1   UAB "DIAMEDICA"   2.625,00   
 92  1   UAB 'Linea libera'   44,10   
 92  2   Uždaroji akcinė bendrovė "ARDEOLA"   157,50   
 92  3   UAB "Diagnostinės sistemos"   378,00   
 93  1   UAB 'Linea libera'   22,05   
 93  2   UAB "Diagnostinės sistemos"   84,00   
 94  1   UAB 'Linea libera'   22,05   
 94  2   UAB "Diagnostinės sistemos"   378,00   
 95  1   UAB 'Linea libera'   22,05   
 95  2   UAB "Diagnostinės sistemos"   378,00   
 96  1   UAB 'Linea libera'   22,05   
 96  2   Uždaroji akcinė bendrovė "ARDEOLA"   27,30   
 96  3   UAB "Diagnostinės sistemos"   378,00   
 97  1   UAB 'Linea libera'   22,05   
 97  2   UAB "Diagnostinės sistemos"   378,00   
 98  1   UAB 'Linea libera'   115,50   
 98  2   UAB "Diagnostinės sistemos"   1.890,00   
 99  1   UAB 'Linea libera'   47,25   
 99  2   UAB "Diagnostinės sistemos"   399,00   
 100  1   UAB 'Linea libera'   304,50   
 101  1   UAB 'Linea libera'   152,25   
 102  1   UAB 'Linea libera'   182,70   
 103  1   UAB 'Linea libera'   152,25   
 104  1   UAB 'Linea libera'   60,90   
 105  1   UAB 'Linea libera'   121,80   
 106  1   UAB 'Linea libera'   152,25   
 107  1   UAB 'Linea libera'   365,40   
 108  1   UAB 'Linea libera'   213,15   
 109  1   UAB 'Linea libera'   152,25   
 110  1   UAB 'Linea libera'   60,90   
 111  1   UAB 'Linea libera'   30,45   
 112  1   UAB 'Linea libera'   30,45   
 113  1   UAB 'Linea libera'   60,90   
 114  1   UAB 'Linea libera'   365,40   
 115  1   UAB 'Linea libera'   243,60   
 116  1   UAB 'Linea libera'   243,60   
 117  1   UAB 'Linea libera'   60,90   
 118  1   UAB 'Linea libera'   60,90   
 119  1   UAB 'Linea libera'   365,40   
 120  1   UAB 'Linea libera'   68,44   
 121  1   UAB 'Linea libera'   152,25   
 122  1   UAB 'Linea libera'   91,35   
 123  1   UAB 'Linea libera'   243,60   
 124  1   UAB 'Linea libera'   243,60   
 125  1   UAB 'Linea libera'   182,70   
 126  1   UAB 'Linea libera'   91,35   
 127  1   UAB 'Linea libera'   30,45   
 128  1   UAB 'Linea libera'   60,90   
 129  1   UAB 'Linea libera'   456,75   
 130  1   UAB 'Linea libera'   121,80   
 131  1   UAB 'Linea libera'   121,80   
 132  1   UAB 'Linea libera'   152,25   
 133  1   UAB 'Linea libera'   152,25   
 134  1   UAB 'Linea libera'   91,35   
 135  1   UAB 'Linea libera'   365,40   
 136  1   UAB 'Linea libera'   60,90   
 137  1   UAB 'Linea libera'   152,25   
 138  1   UAB 'Linea libera'   365,40   
 139  1   UAB 'Linea libera'   304,50   
 140  1   UAB 'Linea libera'   30,45   
 141  1   UAB 'Linea libera'   30,45   
 142  1   UAB 'Linea libera'   34,22   
 143  1   UAB 'Linea libera'   34,22   
 144  1   UAB 'Linea libera'   34,22   
 145  1   UAB "DIAMEDICA"   7.788,00   
 145  2   UAB "Diagnostinės sistemos"   15.540,00   
 145  3   UAB 'Interlux'   18.474,08   
 146  1   UAB "Diagnostinės sistemos"   5.071,50   
 146  2   UAB "Oriola–Vilnius"   4.152,75   
 146  3   UAB 'Interlux'   7.549,64   
 147  1   UAB "Diagnostinės sistemos"   4.347,00   
 147  2   UAB 'Interlux'   6.471,12   
 148  1   UAB "Diagnostinės sistemos"   1.197,00   
 148  2   UAB 'Interlux'   3.235,56   
 149  1   Uždaroji akcinė bendrovė "GENERIX"   798,00   
 149  2   UAB 'Interlux'   1.033,20   
 150  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 150  2   UAB 'Interlux'   1.033,20   
 151  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 151  2   UAB 'Interlux'   1.033,20   
 152  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 152  2   UAB 'Interlux'   1.033,20   
 153  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 153  2   UAB 'Interlux'   1.033,20   
 154  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 154  2   UAB 'Interlux'   1.033,20   
 155  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 155  2   UAB 'Interlux'   1.033,20   
 156  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 156  2   UAB 'Interlux'   1.033,20   
 157  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 157  2   UAB 'Interlux'   1.033,20   
 158  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 158  2   UAB 'Interlux'   1.033,20   
 159  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 159  2   UAB 'Interlux'   1.033,20   
 160  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 160  2   UAB 'Interlux'   1.033,20   
 161  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 161  2   UAB 'Interlux'   1.033,20   
 162  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 162  2   UAB 'Interlux'   1.033,20   
 163  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 163  2   UAB 'Interlux'   1.033,20   
 164  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 164  2   UAB 'Interlux'   1.033,20   
 165  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 165  2   UAB 'Interlux'   1.033,20   
 166  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 166  2   UAB 'Interlux'   1.033,20   
 167  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 167  2   UAB 'Interlux'   1.033,20   
 168  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 168  2   UAB 'Interlux'   1.033,20   
 169  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 169  2   UAB 'Interlux'   1.033,20   
 170  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 170  2   UAB 'Interlux'   1.033,20   
 171  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 171  2   UAB 'Interlux'   1.033,20   
 172  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 172  2   UAB 'Interlux'   1.033,20   
 173  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 173  2   UAB 'Interlux'   1.033,20   
 174  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 174  2   UAB 'Interlux'   1.033,20   
 175  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 175  2   UAB 'Interlux'   1.033,20   
 176  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 176  2   UAB 'Interlux'   1.033,20   
 177  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 177  2   UAB 'Interlux'   1.033,20   
 178  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 178  2   UAB 'Interlux'   1.033,20   
 179  1   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 179  2   UAB 'Interlux'   1.033,20   
 180  1   Uždaroji akcinė bendrovė "ARDEOLA"   331,80   
 180  2   Uždaroji akcinė bendrovė "GENERIX"   399,00   
 180  3   UAB 'Interlux'   4.132,80   
 181  1   Uždaroji akcinė bendrovė "ARDEOLA"   331,80   
 181  2   Uždaroji akcinė bendrovė "GENERIX"   399,00   
 181  3   UAB 'Interlux'   4.132,80   
 182  1   Uždaroji akcinė bendrovė "GENERIX"   84,00   
 182  2   UAB 'Interlux'   1.033,20   
 183  1   Uždaroji akcinė bendrovė "GENERIX"   84,00   
 183  2   UAB 'Interlux'   1.033,20   
 184  1   Uždaroji akcinė bendrovė "GENERIX"   84,00   
 184  2   UAB 'Interlux'   1.033,20   
 185  1   Uždaroji akcinė bendrovė "GENERIX"   84,00   
 185  2   UAB 'Interlux'   1.033,20   
 186  1   Uždaroji akcinė bendrovė "GENERIX"   84,00   
 186  2   UAB 'Interlux'   1.033,20   
 187  1   Uždaroji akcinė bendrovė "GENERIX"   84,00   
 187  2   UAB 'Interlux'   1.033,20   
 188  1   Uždaroji akcinė bendrovė "GENERIX"   84,00   
 188  2   UAB 'Interlux'   1.033,20   
 189  1   Uždaroji akcinė bendrovė "GENERIX"   84,00   
 189  2   UAB 'Interlux'   1.033,20   
 190  1   Uždaroji akcinė bendrovė "GENERIX"   84,00   
 190  2   UAB 'Interlux'   1.033,20   
 191  1   Uždaroji akcinė bendrovė "GENERIX"   682,50   
 191  2   Uždaroji akcinė bendrovė "ARDEOLA"   934,50   
 191  3   UAB "Oriola–Vilnius"   1.039,50   
 191  4   UAB 'Interlux'   5.166,00   
 192  1   Uždaroji akcinė bendrovė "GENERIX"   682,50   
 192  2   Uždaroji akcinė bendrovė "ARDEOLA"   373,80   
 192  3   UAB "Oriola–Vilnius"   1.039,50   
 192  4   UAB 'Interlux'   2.066,40   
 193  1   Uždaroji akcinė bendrovė "GENERIX"   136,50   
 193  2   UAB "Oriola–Vilnius"   207,90   
 193  3   UAB 'Interlux'   1.033,20   
 194  1   Uždaroji akcinė bendrovė "GENERIX"   136,50   
 194  2   UAB "Oriola–Vilnius"   207,90   
 194  3   UAB 'Interlux'   1.033,20   
 195  1   Uždaroji akcinė bendrovė "GENERIX"   218,30   
 196  1   Uždaroji akcinė bendrovė "GENERIX"   218,30   
 197  1   Uždaroji akcinė bendrovė "GENERIX"   218,30   
 198  1   Uždaroji akcinė bendrovė "GENERIX"   218,30   
 199  1   Uždaroji akcinė bendrovė "GENERIX"   218,30   
 200  1   Uždaroji akcinė bendrovė "GENERIX"   218,30   
 201  1   Uždaroji akcinė bendrovė "ARDEOLA"   546,00   
 201  2   UAB "Oriola–Vilnius"   2.940,00   
 202  1   Uždaroji akcinė bendrovė "ARDEOLA"   273,00   
 202  2   UAB "Oriola–Vilnius"   787,50   
 203  1   Uždaroji akcinė bendrovė "ARDEOLA"   273,00   
 203  2   UAB "Oriola–Vilnius"   787,50   
 204  1   Uždaroji akcinė bendrovė "ARDEOLA"   273,00   
 204  2   UAB "Oriola–Vilnius"   787,50   
 205  1   Uždaroji akcinė bendrovė "ARDEOLA"   546,00   
 205  2   UAB "Oriola–Vilnius"   1.575,00   
 206  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 206  2   UAB "Oriola–Vilnius"   382,20   
 207  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 207  2   UAB "Oriola–Vilnius"   382,20   
 208  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 208  2   UAB "Oriola–Vilnius"   382,20   
 209  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 209  2   UAB "Oriola–Vilnius"   382,20   
 210  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 210  2   UAB "Oriola–Vilnius"   382,20   
 211  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 211  2   UAB "Oriola–Vilnius"   382,20   
 212  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 212  2   UAB "Oriola–Vilnius"   382,20   
 213  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 213  2   UAB "Oriola–Vilnius"   382,20   
 214  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 214  2   UAB "Oriola–Vilnius"   382,20   
 215  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 215  2   UAB "Oriola–Vilnius"   382,20   
 216  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 216  2   UAB "Oriola–Vilnius"   382,20   
 217  1   Uždaroji akcinė bendrovė "ARDEOLA"   77,70   
 217  2   UAB "Oriola–Vilnius"   382,20   
 218  1   Uždaroji akcinė bendrovė "ARDEOLA"   399,00   
 218  2   UAB "Oriola–Vilnius"   415,80   
 219  1   Uždaroji akcinė bendrovė "ARDEOLA"   756,00   
 219  2   UAB "Oriola–Vilnius"   1.121,40   
 220  1   Uždaroji akcinė bendrovė "ARDEOLA"   308,70   
 220  2   UAB "Oriola–Vilnius"   1.121,40   
 221  1   Uždaroji akcinė bendrovė "ARDEOLA"   279,30   
 221  2   UAB "Oriola–Vilnius"   747,60   
 222  1   Uždaroji akcinė bendrovė "ARDEOLA"   279,30   
 222  2   UAB "Oriola–Vilnius"   747,60   
 223  1   Uždaroji akcinė bendrovė "ARDEOLA"   382,20   
 223  2   UAB "Oriola–Vilnius"   747,60   
 224  1   UAB "Oriola–Vilnius"   373,80   
 224  2   Uždaroji akcinė bendrovė "ARDEOLA"   378,00   
 225  1   Uždaroji akcinė bendrovė "ARDEOLA"   191,10   
 225  2   UAB "Oriola–Vilnius"   373,80   
 226  1   Uždaroji akcinė bendrovė "ARDEOLA"   191,10   
 226  2   UAB "Oriola–Vilnius"   373,80   
 227  1   Uždaroji akcinė bendrovė "ARDEOLA"   191,10   
 227  2   UAB "Oriola–Vilnius"   373,80   
 228  1   Uždaroji akcinė bendrovė "ARDEOLA"   191,10   
 228  2   UAB "Oriola–Vilnius"   373,80   
 229  1   Uždaroji akcinė bendrovė "ARDEOLA"   191,10   
 229  2   UAB "Oriola–Vilnius"   373,80   
 230  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 230  2   UAB "Oriola–Vilnius"   294,00   
 231  1   Uždaroji akcinė bendrovė "ARDEOLA"   357,00   
 231  2   UAB "Oriola–Vilnius"   1.176,00   
 232  1   UAB "Oriola–Vilnius"   294,00   
 233  1   Uždaroji akcinė bendrovė "ARDEOLA"   178,50   
 233  2   UAB "Oriola–Vilnius"   1.047,90   
 234  1   Uždaroji akcinė bendrovė "ARDEOLA"   178,50   
 234  2   UAB "Oriola–Vilnius"   1.047,90   
 235  1   Uždaroji akcinė bendrovė "ARDEOLA"   178,50   
 235  2   UAB "Oriola–Vilnius"   747,60   
 236  1   Uždaroji akcinė bendrovė "ARDEOLA"   357,00   
 236  2   UAB "Oriola–Vilnius"   1.176,00   
 237  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 237  2   UAB "Oriola–Vilnius"   294,00   
 238  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 238  2   UAB "Oriola–Vilnius"   294,00   
 239  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 239  2   UAB "Oriola–Vilnius"   294,00   
 240  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 240  2   UAB "Oriola–Vilnius"   294,00   
 241  1   UAB "Oriola–Vilnius"   89,25   
 242  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 242  2   UAB "Oriola–Vilnius"   294,00   
 243  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 243  2   UAB "Oriola–Vilnius"   294,00   
 244  1   UAB "Oriola–Vilnius"   214,20   
 245  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 245  2   UAB "Oriola–Vilnius"   308,70   
 246  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 246  2   UAB "Oriola–Vilnius"   294,00   
 247  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 247  2   UAB "Oriola–Vilnius"   294,00   
 248  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 248  2   UAB "Oriola–Vilnius"   294,00   
 249  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 249  2   UAB "Oriola–Vilnius"   294,00   
 250  1   UAB "Oriola–Vilnius"   373,80   
 251  1   Uždaroji akcinė bendrovė "ARDEOLA"   241,50   
 251  2   Uždaroji akcinė bendrovė "ARDEOLA"   178,50   
 251  3   UAB "Oriola–Vilnius"   504,00   
 252  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 252  2   UAB "Oriola–Vilnius"   294,00   
 253  1   Uždaroji akcinė bendrovė "ARDEOLA"   529,20   
 253  2   UAB "Oriola–Vilnius"   1.495,20   
 254  1   Uždaroji akcinė bendrovė "ARDEOLA"   243,60   
 254  2   UAB "Oriola–Vilnius"   428,40   
 255  1   Uždaroji akcinė bendrovė "ARDEOLA"   216,30   
 255  2   UAB "Oriola–Vilnius"   588,00   
 256  1   UAB "Oriola–Vilnius"   214,20   
 256  2   Uždaroji akcinė bendrovė "ARDEOLA"   472,50   
 256  3   UAB 'Linea libera'   604,80   
 257  1   Uždaroji akcinė bendrovė "ARDEOLA"   309,75   
 257  2   UAB "Oriola–Vilnius"   214,20   
 258  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 258  2   UAB "Oriola–Vilnius"   294,00   
 259  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 259  2   UAB "Oriola–Vilnius"   294,00   
 260  1   Uždaroji akcinė bendrovė "ARDEOLA"   89,25   
 260  2   UAB "Oriola–Vilnius"   294,00   
 261  1   UAB "Oriola–Vilnius"   214,20   
 261  2   Uždaroji akcinė bendrovė "ARDEOLA"   414,75   
 262  1   UAB "Oriola–Vilnius"   214,20   
 262  2   Uždaroji akcinė bendrovė "ARDEOLA"   325,50   
 263  1   UAB "Oriola–Vilnius"   107,10   
 264  1   Uždaroji akcinė bendrovė "ARDEOLA"   173,25   
 264  2   UAB "Oriola–Vilnius"   214,20   
 265  1   Uždaroji akcinė bendrovė "ARDEOLA"   173,25   
 265  2   UAB "Oriola–Vilnius"   214,20   
 266  1   UAB "Oriola–Vilnius"   107,10   
 267  1   Uždaroji akcinė bendrovė "ARDEOLA"   173,25   
 267  2   UAB "Oriola–Vilnius"   214,20   
 268  1   Uždaroji akcinė bendrovė "ARDEOLA"   504,00   
 268  2   UAB "Oriola–Vilnius"   588,00   
 269  1   Uždaroji akcinė bendrovė "ARDEOLA"   336,00   
 269  2   UAB "Oriola–Vilnius"   588,00   
 270  1   UAB "Oriola–Vilnius"   428,40   
 270  2   Uždaroji akcinė bendrovė "ARDEOLA"   651,00   
 271  1   Uždaroji akcinė bendrovė "ARDEOLA"   399,00   
 271  2   UAB "Oriola–Vilnius"   588,00   
 272  1   Uždaroji akcinė bendrovė "GENERIX"   352,80   
 272  2   UAB 'Interlux'   394,38   
 272  3   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   897,75   
 272  4   Uždaroji akcinė bendrovė "LABOCHEMA"   1.071,91   
 273  1   Uždaroji akcinė bendrovė "GENERIX"   52,50   
 273  2   UAB 'Genomas'   154,51   
 273  3   UAB 'Interlux'   135,66   
 273  4   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   94,50   
 274  1   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   183,75   
 275  1   UAB "DIAMEDICA"   495,60   
 276  1   UAB "DIAMEDICA"   7.257,00   
 277  1   UAB "DIAMEDICA"   977,04   
 278  1   UAB "DIAMEDICA"   977,04   
 279  1   UAB "DIAMEDICA"   247,80   
 280  1   UAB "DIAMEDICA"   354,00   
 281  1   Uždaroji akcinė bendrovė "Bioeksma"   1.180,00   
 282  1   Uždaroji akcinė bendrovė "Bioeksma"   944,00   
 283  1   Uždaroji akcinė bendrovė "Bioeksma"   660,80   
 287  1   UAB 'Interlux'   1.076,16   
 287  2   UAB "DIAMEDICA"   1.416,00   
 288  1   Uždaroji akcinė bendrovė "Bioeksma"   1.038,40   
 289  1   UAB 'Interlux'   54,28   
 290  1   UAB 'Interlux'   2.817,84   
 291  1   UAB 'Interlux'   0,00   
 292  1   UAB 'Interlux'   4.428,54   
 293  1   L. R. Tamulio firma "Meditalika"   341,25   
 293  2   A. Zapalskio IĮ "Azas"   392,70   
 293  3   UAB 'Interlux'   420,00   
 293  4   UAB "Oriola–Vilnius"   735,00   
 294  1   UAB "Oriola–Vilnius"   119,09   
 294  2   Uždaroji akcinė bendrovė "Bioeksma"   135,70   
 294  3   Uždaroji akcinė bendrovė "LABOCHEMA"   153,40   
 295  1   Uždaroji akcinė bendrovė "Bioeksma"   100,30   
 295  2   UAB "Oriola–Vilnius"   101,48   
 295  3   Uždaroji akcinė bendrovė "LABOCHEMA"   151,04   
 296  1   Uždaroji akcinė bendrovė "Bioeksma"   25,96   
 296  2   UAB "Oriola–Vilnius"   30,09   
 296  3   Uždaroji akcinė bendrovė "LABOCHEMA"   41,30   
 297  1   UAB "Oriola–Vilnius"   33,75   
 297  2   Uždaroji akcinė bendrovė "Bioeksma"   60,18   
 297  3   Uždaroji akcinė bendrovė "LABOCHEMA"   88,50   
 298  1   UAB "DIAMEDICA"   236,00   
 299  1   UAB "Oriola–Vilnius"   36,75   
 299  2   Uždaroji akcinė bendrovė "LABOCHEMA"   41,30   
 299  3   Uždaroji akcinė bendrovė "Bioeksma"   64,90   
 300  1   UAB "Oriola–Vilnius"   7.431,38   
 300  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   8.998,88   
 300  3   UAB 'Interlux'   9.670,10   
 300  4   Uždaroji akcinė bendrovė "SUVA"   10.988,75   
 300  5   Uždaroji akcinė bendrovė "Bioeksma"   13.186,50   
 301  1   UAB "Oriola–Vilnius"   3.969,00   
 301  2   Uždaroji akcinė bendrovė "Bioeksma"   4.441,50   
 301  3   UAB 'Interlux'   4.885,20   
 301  4   Uždaroji akcinė bendrovė "SUVA"   5.947,20   
 301  5   Uždaroji akcinė bendrovė "Bioeksma"   9.558,00   
 302  1   UAB "Oriola–Vilnius"   191,75   
 302  2   Uždaroji akcinė bendrovė "Bioeksma"   200,60   
 302  3   Uždaroji akcinė bendrovė "Bioeksma"   295,00   
 302  4   Uždaroji akcinė bendrovė "LABOCHEMA"   498,90   
 303  1   Uždaroji akcinė bendrovė "LABOCHEMA"   677,32   
 305  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   289,10   
 305  2   Uždaroji akcinė bendrovė "LABOCHEMA"   631,30   
 306  1   Uždaroji akcinė bendrovė "LABOCHEMA"   660,80   
 307  1   Uždaroji akcinė bendrovė "Bioeksma"   20,06   
 307  2   Uždaroji akcinė bendrovė "LABOCHEMA"   187,62   
 307  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   416,54   
 308  1   Uždaroji akcinė bendrovė "Bioeksma"   33,04   
 308  2   Uždaroji akcinė bendrovė "LABOCHEMA"   187,42   
 308  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   428,34   
 309  1   Uždaroji akcinė bendrovė "Bioeksma"   165,20   
 309  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   2.832,00   
 310  1   UAB "DIAMEDICA"   708,00   
 311  1   Uždaroji akcinė bendrovė "GENERIX"   10.174,50   
 311  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   10.977,75   
 311  3   Uždaroji akcinė bendrovė "Bioeksma"   15.045,00   
 311  4   Uždaroji akcinė bendrovė "SUVA"   18.060,37   
 312  1   Uždaroji akcinė bendrovė "LABMED"   28.910,00   
 312  2   Uždaroji akcinė bendrovė "Bioeksma"   35.000,00   
 313  1   Uždaroji akcinė bendrovė "GENERIX"   1.512,00   
 313  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.680,00   
 313  3   UAB "Oriola–Vilnius"   1.680,00   
 313  4   Uždaroji akcinė bendrovė "SUVA"   2.162,70   
 313  5   Uždaroji akcinė bendrovė "Bioeksma"   2.720,00   
 314  1   Uždaroji akcinė bendrovė "GENERIX"   567,00   
 314  2   UAB "Oriola–Vilnius"   582,75   
 314  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   598,50   
 314  4   Uždaroji akcinė bendrovė "Bioeksma"   1.170,00   
 314  5   UAB "DIAMEDICA"   7.699,50   
 316  1   L. R. Tamulio firma "Meditalika"   504,00   
 316  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   649,00   
 316  3   Uždaroji akcinė bendrovė "Bioeksma"   2.065,00   
 317  1   Uždaroji akcinė bendrovė "SUVA"   3.398,40   
 318  1   A. Zapalskio IĮ "Azas"   57,48   
 318  2   Uždaroji akcinė bendrovė "GENERIX"   102,64   
 318  3   UAB 'Interlux'   118,61   
 318  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   144,90   
 319  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   826,00   
 320  1   Uždaroji akcinė bendrovė "GENERIX"   31,50   
 320  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   57,75   
 321  1   Uždaroji akcinė bendrovė "GENERIX"   136,50   
 321  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   163,80   
 322  1   Uždaroji akcinė bendrovė "SUVA"   708,00   
 322  2   Uždaroji akcinė bendrovė "Bioeksma"   1.250,80   
 322  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.392,40   
 323  1   A. Zapalskio IĮ "Azas"   46,73   
 323  2   A. Tamošiūno įmonė   53,90   
 323  3   UAB "Oriola–Vilnius"   148,68   
 324  1   UAB "Oriola–Vilnius"   796,50   
 325  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   2.463,84   
 325  2   UAB "Oriola–Vilnius"   2.548,80   
 325  3   UAB 'Interlux'   2.394,00   
 325  4   Uždaroji akcinė bendrovė "Bioeksma"   3.256,80   
 326  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   849,60   
 326  2   Uždaroji akcinė bendrovė "SUVA"   1.295,64   
 326  3   Uždaroji akcinė bendrovė "Bioeksma"   7.858,80   
 326  4   L. R. Tamulio firma "Meditalika"   3.016,08   
 327  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   63,00   
 327  2   UAB "Oriola–Vilnius"   73,16   
 327  3   Uždaroji akcinė bendrovė "SUVA"   242,37   
 328  1   L. R. Tamulio firma "Meditalika"   378,00   
 329  1   UAB "Oriola–Vilnius"   12.442,50   
 329  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   13.479,38   
 329  3   Uždaroji akcinė bendrovė "SUVA"   18.644,00   
 329  4   Uždaroji akcinė bendrovė "Bioeksma"   30.296,50   
 330  1   UAB "Oriola–Vilnius"   4.536,00   
 330  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   4.914,00   
 330  3   Uždaroji akcinė bendrovė "SUVA"   6.796,80   
 330  4   Uždaroji akcinė bendrovė "Bioeksma"   11.044,80   
 332  1   A. Tamošiūno įmonė   426,83   
 332  2   A. Zapalskio IĮ "Azas"   472,50   
 333  1   UAB "BIOTECHA"   1.125,72   
 333  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.562,40   
 333  3   Uždaroji akcinė bendrovė "Bioeksma"   2.230,20   
 334  1   Uždaroji akcinė bendrovė "Bioeksma"   15.399,00   
 334  2   Uždaroji akcinė bendrovė "LABOCHEMA"   16.779,60   
 334  3   UAB "Oriola–Vilnius"   17.416,80   
 334  4   UAB "BIOTECHA"   17.523,00   
 334  5   Uždaroji akcinė bendrovė "BIOMETRIJA"   17.841,60   
 335  1   UAB "BIOTECHA"   415,95   
 335  2   Uždaroji akcinė bendrovė "Bioeksma"   430,70   
 335  3   Uždaroji akcinė bendrovė "LABOCHEMA"   2.218,40   
 336  1   A. Tamošiūno įmonė   105,21   
 336  2   A. Zapalskio IĮ "Azas"   116,55   
 337  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   47,20   
 337  2   UAB "Oriola–Vilnius"   56,64   
 337  3   Uždaroji akcinė bendrovė "SUVA"   147,50   
 338  1   UAB "Oriola–Vilnius"   389,40   
 338  2   Uždaroji akcinė bendrovė "Bioeksma"   389,40   
 339  1   A. Zapalskio IĮ "Azas"   291,06   
 339  2   A. Tamošiūno įmonė   292,95   
 340  1   Uždaroji akcinė bendrovė "ARDEOLA"   399,00   
 340  2   UAB 'Interlux'   906,24   
 340  3   UAB 'Linea libera'   945,00   
 340  4   UAB "DIAMEDICA"   2.596,00   
 341  1   UAB "DIAMEDICA"   1.557,60   
 341  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   3.020,80   
 341  3   UAB 'Linea libera'   3.166,80   
 341  4   Uždaroji akcinė bendrovė "LABOCHEMA"   4.012,00   
 343  1   Uždaroji akcinė bendrovė "SUVA"   4,48   
 344  1   Uždaroji akcinė bendrovė "LABOCHEMA"   2.147,60   
 345  1   UAB 'Interlux'   1.043,12   
 345  2   UAB 'Genomas'   632,96   
 346  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   401,20   
 346  2   Uždaroji akcinė bendrovė "ARDEOLA"   542,80   
 346  3   UAB 'Interlux'   571,12   
 347  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   206,50   
 347  2   Uždaroji akcinė bendrovė "ARDEOLA"   159,30   
 347  3   UAB 'Interlux'   1.750,56   
 348  1   UAB 'Linea libera'   2.205,00   
 348  2   UAB 'Interlux'   3.361,23   
 348  3   Uždaroji akcinė bendrovė "Bioeksma"   2.743,50   
 348  4   Uždaroji akcinė bendrovė "ARDEOLA"   2.124,00   
 348  5   Uždaroji akcinė bendrovė "BIOMETRIJA"   2.565,00   
 349  1   UAB 'Linea libera'   3.240,00   
 349  2   UAB 'Interlux'   2.308,08   
 349  3   Uždaroji akcinė bendrovė "Bioeksma"   3.398,40   
 349  4   Uždaroji akcinė bendrovė "ARDEOLA"   7.080,00   
 349  5   Uždaroji akcinė bendrovė "Bioeksma"   7.080,00   
 350  1   UAB 'Linea libera'   1.795,50   
 350  2   Uždaroji akcinė bendrovė "Bioeksma"   1.097,40   
 351  1   UAB 'Linea libera'   1.793,40   
 351  2   Uždaroji akcinė bendrovė "Bioeksma"   5.083,44   
 352  1   UAB 'Linea libera'   1.800,75   
 352  2   Uždaroji akcinė bendrovė "Bioeksma"   2.188,90   
 353  1   UAB 'Linea libera'   312,90   
 353  2   Uždaroji akcinė bendrovė "Bioeksma"   729,24   
 354  1   UAB 'Linea libera'   623,70   
 354  2   Uždaroji akcinė bendrovė "Bioeksma"   3.351,20   
 355  1   UAB 'Linea libera'   747,60   
 355  2   UAB 'Genomas'   1.455,84   
 355  3   Uždaroji akcinė bendrovė "Bioeksma"   1.557,60   
 356  1   Uždaroji akcinė bendrovė "Bioeksma"   590,00   
 356  2   Uždaroji akcinė bendrovė "ARDEOLA"   708,00   
 357  1   UAB 'Linea libera'   519,75   
 357  2   Uždaroji akcinė bendrovė "ARDEOLA"   785,88   
 357  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   807,12   
 357  4   Uždaroji akcinė bendrovė "Bioeksma"   945,18   
 358  1   UAB 'Linea libera'   735,00   
 358  2   Uždaroji akcinė bendrovė "Bioeksma"   1.675,60   
 359  1   UAB 'Linea libera'   1.308,30   
 359  2   Uždaroji akcinė bendrovė "Bioeksma"   3.361,82   
 360  1   Uždaroji akcinė bendrovė "Bioeksma"   371,70   
 360  2   UAB 'Interlux'   5.645,12   
 360  3   UAB 'Linea libera'   1.059,57   
 361  1   UAB 'Linea libera'   151,20   
 361  2   Uždaroji akcinė bendrovė "Bioeksma"   181,72   
 361  3   UAB 'Interlux'   193,52   
 361  4   UAB 'Genomas'   217,17   
 362  1   UAB 'Linea libera'   203,70   
 364  1   UAB 'Linea libera'   1.444,80   
 364  2   UAB 'Genomas'   2.119,60   
 364  3   Uždaroji akcinė bendrovė "Bioeksma"   2.699,84   
 365  1   Uždaroji akcinė bendrovė "Bioeksma"   244,26   
 365  2   UAB 'Linea libera'   494,55   
 365  3   Uždaroji akcinė bendrovė "Bioeksma"   545,16   
 365  4   UAB 'Genomas'   612,42   
 366  1   UAB 'Linea libera'   127,05   
 366  2   Uždaroji akcinė bendrovė "Bioeksma"   127,44   
 366  3   UAB 'Genomas'   171,56   
 369  1   UAB 'Interlux'   453,12   
 370  1   UAB 'Linea libera'   535,50   
 370  2   Uždaroji akcinė bendrovė "Bioeksma"   941,64   
 370  3   Uždaroji akcinė bendrovė "LABOCHEMA"   179,14   
 371  1   UAB 'Interlux'   199,42   
 371  2   Uždaroji akcinė bendrovė "Bioeksma"   212,40   
 371  3   UAB 'Genomas'   246,27   
 372  1   Uždaroji akcinė bendrovė "ARDEOLA"   162,84   
 372  2   UAB 'Interlux'   470,82   
 373  1   UAB 'Linea libera'   207,90   
 373  2   Uždaroji akcinė bendrovė "Bioeksma"   318,60   
 373  3   Uždaroji akcinė bendrovė "ARDEOLA"   318,60   
 374  1   UAB 'Linea libera'   470,40   
 374  2   Uždaroji akcinė bendrovė "Bioeksma"   548,70   
 374  3   Uždaroji akcinė bendrovė "ARDEOLA"   849,60   
 375  1   UAB 'Linea libera'   260,40   
 376  1   UAB 'Linea libera'   132,30   
 376  2   Uždaroji akcinė bendrovė "ARDEOLA"   96,76   
 377  1   UAB 'Linea libera'   0,00   
 377  2   Uždaroji akcinė bendrovė "ARDEOLA"   684,40   
 378  1   UAB 'Linea libera'   2.499,00   
 378  2   Uždaroji akcinė bendrovė "ARDEOLA"   3.885,00   
 378  3   UAB 'Genomas'   6.949,40   
 378  4   Uždaroji akcinė bendrovė "Bioeksma"   7.080,00   
 379  1   UAB 'Linea libera'   1.128,75   
 379  2   Uždaroji akcinė bendrovė "Bioeksma"   1.994,20   
 380  1   UAB 'Linea libera'   2.406,60   
 380  2   Uždaroji akcinė bendrovė "Bioeksma"   4.720,00   
 381  1   Uždaroji akcinė bendrovė "ARDEOLA"   115,64   
 381  2   UAB 'Interlux'   401,20   
 381  3   UAB 'Linea libera'   505,05   
 382  1   UAB 'Linea libera'   2.803,50   
 382  2   Uždaroji akcinė bendrovė "Bioeksma"   5.310,00   
 382  3   UAB 'Genomas'   6.736,63   
 383  1   UAB 'Interlux'   508,82   
 383  2   Uždaroji akcinė bendrovė "ARDEOLA"   536,90   
 383  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   654,15   
 383  4   UAB 'Linea libera'   672,00   
 383  5   Uždaroji akcinė bendrovė "Bioeksma"   949,90   
 384  1   UAB 'Linea libera'   787,50   
 384  2   Uždaroji akcinė bendrovė "Bioeksma"   1.180,00   
 384  3   UAB 'Interlux'   1.470,28   
 385  1   UAB 'Linea libera'   592,20   
 386  1   UAB 'Linea libera'   835,80   
 387  1   UAB 'Linea libera'   7.313,25   
 388  1   UAB 'Linea libera'   1.253,70   
 389  1   UAB 'Interlux'   10.476,04   
 390  1   UAB 'Linea libera'   114,45   
 390  2   Uždaroji akcinė bendrovė "ARDEOLA"   295,00   
 390  3   Uždaroji akcinė bendrovė "Bioeksma"   241,90   
 391  1   UAB 'Linea libera'   257,24   
 391  2   Uždaroji akcinė bendrovė "ARDEOLA"   495,60   
 391  3   Uždaroji akcinė bendrovė "Bioeksma"   826,00   
 392  1   UAB 'Linea libera'   339,84   
 392  2   UAB 'Genomas'   430,00   
 392  3   Uždaroji akcinė bendrovė "Bioeksma"   533,36   
 393  1   UAB 'Linea libera'   114,45   
 393  2   UAB 'Genomas'   138,99   
 394  1   UAB 'Linea libera'   1.121,40   
 394  2   Uždaroji akcinė bendrovė "Bioeksma"   1.486,80   
 395  1   UAB 'Linea libera'   441,00   
 395  2   UAB 'Genomas'   908,64   
 395  3   Uždaroji akcinė bendrovė "Bioeksma"   1.888,00   
 396  1   UAB 'Linea libera'   407,10   
 396  2   Uždaroji akcinė bendrovė "Bioeksma"   407,10   
 397  1   Uždaroji akcinė bendrovė "ARDEOLA"   241,90   
 397  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   245,00   
 397  3   UAB 'Linea libera'   259,88   
 399  1   Uždaroji akcinė bendrovė "ARDEOLA"   155,76   
 399  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   186,90   
 399  3   UAB 'Linea libera'   262,50   
 399  4   Uždaroji akcinė bendrovė "Bioeksma"   460,20   
 399  5   UAB 'Genomas'   529,90   
 400  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   560,70   
 400  2   Uždaroji akcinė bendrovė "Bioeksma"   1.416,00   
 400  3   UAB 'Linea libera'   1.550,52   
 401  1   Uždaroji akcinė bendrovė "Bioeksma"   346,92   
 401  2   UAB 'Genomas'   466,68   
 401  3   UAB 'Linea libera'   476,72   
 402  1   UAB 'Interlux'   1.034,15   
 402  2   Uždaroji akcinė bendrovė "ARDEOLA"   1.073,80   
 402  3   UAB 'Linea libera'   1.602,30   
 402  4   Uždaroji akcinė bendrovė "Bioeksma"   1.652,00   
 403  1   Uždaroji akcinė bendrovė "Bioeksma"   1.109,20   
 403  2   UAB 'Linea libera'   424,80   
 404  1   Uždaroji akcinė bendrovė "Bioeksma"   0,00   
 404  2   UAB 'Linea libera'   1.155,00   
 405  1   UAB 'Linea libera'   483,00   
 405  2   Uždaroji akcinė bendrovė "Bioeksma"   783,52   
 406  1   UAB 'Linea libera'   1.386,00   
 406  2   Uždaroji akcinė bendrovė "Bioeksma"   2.017,80   
 407  1   UAB 'Linea libera'   228,90   
 407  2   Uždaroji akcinė bendrovė "Bioeksma"   505,04   
 408  1   UAB 'Linea libera'   289,80   
 408  2   Uždaroji akcinė bendrovė "Bioeksma"   644,28   
 409  1   UAB 'Linea libera'   162,84   
 409  2   Uždaroji akcinė bendrovė "Bioeksma"   217,12   
 409  3   Uždaroji akcinė bendrovė "ARDEOLA"   247,80   
 409  4   UAB 'Genomas'   1.943,24   
 410  1   UAB 'Linea libera'   98,70   
 410  2   UAB 'Interlux'   157,18   
 410  3   Uždaroji akcinė bendrovė "Bioeksma"   165,20   
 411  1   UAB 'Linea libera'   2.079,00   
 412  1   UAB 'Linea libera'   160,65   
 413  1   Uždaroji akcinė bendrovė "Bioeksma"   116,82   
 413  2   UAB 'Linea libera'   120,75   
 413  3   UAB 'Genomas'   225,28   
 414  1   UAB 'Linea libera'   196,35   
 414  2   Uždaroji akcinė bendrovė "Bioeksma"   212,40   
 415  1   UAB 'Linea libera'   415,80   
 415  2   Uždaroji akcinė bendrovė "Bioeksma"   500,32   
 416  1   UAB 'Linea libera'   105,02   
 416  2   Uždaroji akcinė bendrovė "Bioeksma"   165,20   
 416  3   UAB 'Genomas'   264,53   
 416  4   Uždaroji akcinė bendrovė "ARDEOLA"   283,20   
 417  1   UAB 'Linea libera'   1.869,12   
 417  2   Uždaroji akcinė bendrovė "Bioeksma"   2.001,28   
 418  1   Uždaroji akcinė bendrovė "ARDEOLA"   100,30   
 418  2   Uždaroji akcinė bendrovė "Bioeksma"   125,08   
 418  3   UAB 'Linea libera'   171,10   
 419  1   UAB 'Linea libera'   433,65   
 420  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.486,80   
 420  2   Uždaroji akcinė bendrovė "ARDEOLA"   1.628,40   
 420  3   UAB 'Linea libera'   1.752,30   
 420  4   Uždaroji akcinė bendrovė "Bioeksma"   2.301,00   
 421  1   UAB 'Linea libera'   535,50   
 421  2   UAB 'Genomas'   729,72   
 421  3   Uždaroji akcinė bendrovė "Bioeksma"   877,92   
 422  1   UAB 'Linea libera'   1.019,52   
 422  2   Uždaroji akcinė bendrovė "Bioeksma"   1.189,44   
 422  3   Uždaroji akcinė bendrovė "ARDEOLA"   1.508,04   
 423  1   Uždaroji akcinė bendrovė "ARDEOLA"   76,60   
 423  2   UAB 'Linea libera'   135,45   
 423  3   UAB 'Interlux'   345,74   
 424  1   UAB 'Linea libera'   1.102,50   
 424  2   Uždaroji akcinė bendrovė "Bioeksma"   1.947,00   
 425  1   UAB 'Interlux'   1.343,08   
 425  2   Uždaroji akcinė bendrovė "ARDEOLA"   2.053,20   
 425  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   2.406,60   
 425  4   UAB 'Linea libera'   2.614,50   
 425  5   Uždaroji akcinė bendrovė "Bioeksma"   3.115,20   
 426  1   UAB 'Linea libera'   630,00   
 426  2   Uždaroji akcinė bendrovė "Bioeksma"   641,92   
 427  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   501,90   
 427  2   Uždaroji akcinė bendrovė "ARDEOLA"   542,80   
 427  3   Uždaroji akcinė bendrovė "Bioeksma"   1.165,84   
 428  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   420,08   
 428  2   UAB 'Linea libera'   467,28   
 428  3   Uždaroji akcinė bendrovė "Bioeksma"   580,56   
 429  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   186,44   
 429  2   Uždaroji akcinė bendrovė "Bioeksma"   228,92   
 429  3   UAB 'Linea libera'   233,64   
 430  1   UAB 'Linea libera'   1.039,50   
 430  2   Uždaroji akcinė bendrovė "Bioeksma"   1.451,40   
 430  3   UAB 'Genomas'   2.115,20   
 431  1   UAB 'Linea libera'   1.352,40   
 432  1   UAB 'Linea libera'   254,10   
 433  1   UAB 'Linea libera'   762,30   
 434  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   154,35   
 434  2   UAB 'Linea libera'   173,25   
 434  3   UAB 'Interlux'   630,00   
 435  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   18.690,00   
 436  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.680,00   
 437  1   Uždaroji akcinė bendrovė "Bioeksma"   110,92   
 438  1   Uždaroji akcinė bendrovė "Bioeksma"   47,20   
 439  1   UAB "DIAMEDICA"   233,64   
 439  2   Uždaroji akcinė bendrovė "Bioeksma"   306,80   
 440  1   UAB 'Genomas'   61,78   
 440  2   Uždaroji akcinė bendrovė "Bioeksma"   66,08   
 441  1   Uždaroji akcinė bendrovė "Bioeksma"   266,68   
 442  1   UAB 'Genomas'   206,97   
 442  2   Uždaroji akcinė bendrovė "Bioeksma"   264,32   
 443  1   Uždaroji akcinė bendrovė "Bioeksma"   198,24   
 444  1   Uždaroji akcinė bendrovė "Bioeksma"   199,42   
 445  1   UAB 'Genomas'   39,98   
 445  2   Uždaroji akcinė bendrovė "Bioeksma"   118,00   
 446  1   Uždaroji akcinė bendrovė "Bioeksma"   454,30   
 447  1   Uždaroji akcinė bendrovė "Bioeksma"   212,40   
 447  2   UAB 'Interlux'   431,88   
 447  3   UAB "DIAMEDICA"   991,20   
 448  1   Uždaroji akcinė bendrovė "Bioeksma"   84,96   
 449  1   UAB 'Linea libera'   682,50   
 450  1   Uždaroji akcinė bendrovė "Bioeksma"   70,80   
 451  1   UAB 'Linea libera'   7.786,80   
 452  1   Uždaroji akcinė bendrovė "GENERIX"   1.732,50   
 452  2   UAB 'Interlux'   2.457,00   
 453  1   Uždaroji akcinė bendrovė "GENERIX"   1.732,50   
 453  2   UAB 'Interlux'   2.457,00   
 454  1   Uždaroji akcinė bendrovė "GENERIX"   2.310,00   
 454  2   UAB 'Interlux'   4.116,00   
 455  1   Uždaroji akcinė bendrovė "GENERIX"   73,50   
 455  2   UAB 'Interlux'   479,08   
 456  1   Uždaroji akcinė bendrovė "GENERIX"   630,00   
 456  2   UAB 'Interlux'   1.274,40   
 456  3   Uždaroji akcinė bendrovė "Bioeksma"   2.902,80   
 457  1   A. Zapalskio IĮ "Azas"   5,88   
 457  2   Uždaroji akcinė bendrovė "GENERIX"   23,63   
 457  3   UAB 'Interlux'   35,40   
 458  1   Uždaroji akcinė bendrovė "GENERIX"   252,00   
 458  2   UAB 'Interlux'   302,40   
 458  3   A. Zapalskio IĮ "Azas"   312,48   
 458  4   Uždaroji akcinė bendrovė "SUVA"   696,00   
 459  1   UAB 'Interlux'   470,40   
 459  2   A. Zapalskio IĮ "Azas"   584,64   
 459  3   Uždaroji akcinė bendrovė "SUVA"   1.120,00   
 460  1   Uždaroji akcinė bendrovė "Bioeksma"   578,20   
 461  1   UAB "DIAMEDICA"   525,00   
 461  2   A. Zapalskio IĮ "Azas"   2.289,00   
 462  1   UAB "DIAMEDICA"   319,20   
 462  2   A. Zapalskio IĮ "Azas"   23.940,00   
 463  1   A. Zapalskio IĮ "Azas"   73,58   
 463  2   A. Tamošiūno įmonė   86,94   
 464  1   A. Tamošiūno įmonė   30,00   
 464  2   A. Zapalskio IĮ "Azas"   38,56   
 465  1   Uždaroji akcinė bendrovė "SUVA"   3.965,00   
 465  2   Uždaroji akcinė bendrovė "LABOCHEMA"   4.248,00   
 466  1   Uždaroji akcinė bendrovė "SUVA"   1.109,00   
 466  2   Uždaroji akcinė bendrovė "LABOCHEMA"   1.144,60   
 467  1   UAB "Roche Lietuva"   93,70   
 468  1   UAB "Siemens Medical Solutions Diagnostics"   1.905,75   
 469  1   UAB "Siemens Medical Solutions Diagnostics"   4.712,40   
 470  1   UAB "Siemens Medical Solutions Diagnostics"   1.732,50   
 471  1   UAB "Roche Lietuva"   110,25   
 472  1   UAB "Roche Lietuva"   220,50   
 473  1   UAB "Roche Lietuva"   220,50   
 474  1   UAB "Roche Lietuva"   244,32   
 475  1   UAB "Roche Lietuva"   220,50   
 476  1   UAB "Roche Lietuva"   110,25   
 477  1   UAB "Roche Lietuva"   110,25   
 478  1   UAB "Roche Lietuva"   110,25   
 479  1   UAB "Diagnostinės sistemos"   1.134,00   
 480  1   UAB "Diagnostinės sistemos"   262,50   
 481  1   UAB "Roche Lietuva"   140,70   
 481  2   UAB "Diagnostinės sistemos"   259,60   
 482  1   UAB "Roche Lietuva"   154,70   
 483  1   UAB "Roche Lietuva"   140,70   
 483  2   UAB "Diagnostinės sistemos"   259,56   
 484  1   UAB "Roche Lietuva"   95,56   
 485  1   UAB "Roche Lietuva"   110,30   
 486  1   UAB "Diagnostinės sistemos"   1.890,00   
 487  1   UAB "Diagnostinės sistemos"   298,20   
 488  1   UAB "Diagnostinės sistemos"   298,20   
 489  1   UAB "Roche Lietuva"   93,70   
 490  1   UAB "Siemens Medical Solutions Diagnostics"   446,25   
 491  1   UAB "Siemens Medical Solutions Diagnostics"   866,25   
 492  1   UAB "Siemens Medical Solutions Diagnostics"   131,25   
 493  1   UAB "Siemens Medical Solutions Diagnostics"   157,50   
 494  1   UAB "DIAMEDICA"   562,80   
 495  1   UAB "DIAMEDICA"   646,80   
 496  1   UAB "DIAMEDICA"   1.241,10   
 497  1   UAB "DIAMEDICA"   1.890,00   
 498  1   UAB "DIAMEDICA"   2.079,00   
 499  1   UAB "DIAMEDICA"   1.386,00   
 500  1   UAB "DIAMEDICA"   1.669,50   
 501  1   UAB "DIAMEDICA"   756,00   
 502  1   UAB "DIAMEDICA"   951,30   
 503  1   UAB "DIAMEDICA"   1.653,75   
 504  1   UAB "DIAMEDICA"   1.653,75   
 505  1   UAB "DIAMEDICA"   1.653,75   
 506  1   UAB "DIAMEDICA"   1.653,75   
 507  1   UAB "DIAMEDICA"   735,00   
 508  1   UAB "DIAMEDICA"   735,00   
 509  1   UAB "DIAMEDICA"   1.102,50   
 510  1   UAB "DIAMEDICA"   1.102,50   
 511  1   UAB "DIAMEDICA"   1.470,00   
 512  1   UAB "DIAMEDICA"   1.470,00   
 513  1   UAB "DIAMEDICA"   907,20   
 514  1   UAB "DIAMEDICA"   453,60   
 515  1   UAB "DIAMEDICA"   735,00   
 516  1   UAB "DIAMEDICA"   735,00   
 517  1   UAB "DIAMEDICA"   499,80   
 518  1   UAB "DIAMEDICA"   499,80   
 519  1   UAB "DIAMEDICA"   735,00   
 520  1   UAB 'Interlux'   504,00   
 520  2   UAB 'Genomas'   627,90   
 520  3   UAB "DIAMEDICA"   651,00   
 521  1   UAB 'Interlux'   504,00   
 521  2   UAB 'Genomas'   627,90   
 521  3   UAB "DIAMEDICA"   651,00   
 522  1   UAB 'Genomas'   1.335,60   
 522  2   UAB 'Interlux'   1.411,20   
 523  1   UAB 'Genomas'   2.003,40   
 524  1   UAB 'Genomas'   667,80   
 524  2   UAB 'Interlux'   705,60   
 525  1   UAB 'Genomas'   5.241,60   
 526  1   UAB 'Genomas'   7.425,60   
 527  1   UAB 'Genomas'   1.575,00   
 528  1   Uždaroji akcinė bendrovė "ARDEOLA"   407,10   
 530  1   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   441,00   
 530  2   UAB 'Interlux'   630,00   
 531  1   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   441,00   
 531  2   UAB 'Interlux'   735,00   
 532  1   UAB 'Interlux'   705,60   
 535  1   Uždaroji akcinė bendrovė "Bioeksma"   47,20   
 535  2   O. Žuravliovo įmonė "AVSISTA"   905,00   
 535  3   Uždaroji akcinė bendrovė "LABOCHEMA"   3.057,77   
 535  4   UAB 'Genomas'   4.760,89   
 536  1   O. Žuravliovo įmonė "AVSISTA"   36,88   
 536  2   Uždaroji akcinė bendrovė "Bioeksma"   100,30   
 536  3   UAB "DIAMEDICA"   184,08   
 537  1   O. Žuravliovo įmonė "AVSISTA"   6,14   
 537  2   Uždaroji akcinė bendrovė "Bioeksma"   15,93   
 538  1   Uždaroji akcinė bendrovė "Bioeksma"   60,18   
 538  2   UAB "DIAMEDICA"   165,20   
 539  1   O. Žuravliovo įmonė "AVSISTA"   28,11   
 539  2   Uždaroji akcinė bendrovė "Bioeksma"   60,18   
 539  3   UAB "DIAMEDICA"   89,68   
 540  1   O. Žuravliovo įmonė "AVSISTA"   14,35   
 540  2   UAB "DIAMEDICA"   38,94   
 540  3   Uždaroji akcinė bendrovė "Bioeksma"   62,54   
 541  1   UAB "DIAMEDICA"   106,20   
 541  2   Uždaroji akcinė bendrovė "Bioeksma"   354,00   
 542  1   Uždaroji akcinė bendrovė "Bioeksma"   162,84   
 542  2   Uždaroji akcinė bendrovė "LABOCHEMA"   645,64   
 543  1   Uždaroji akcinė bendrovė "Bioeksma"   1.017,16   
 544  1   UAB "DIAMEDICA"   472,00   
 544  2   Uždaroji akcinė bendrovė "Bioeksma"   826,00   
 545  1   O. Žuravliovo įmonė "AVSISTA"   335,00   
 545  2   Uždaroji akcinė bendrovė "Bioeksma"   454,30   
 545  3   UAB "DIAMEDICA"   613,60   
 545  4   Uždaroji akcinė bendrovė "LABOCHEMA"   696,20   
 546  1   Uždaroji akcinė bendrovė "LABOCHEMA"   30,80   
 546  2   O. Žuravliovo įmonė "AVSISTA"   51,42   
 547  1   Uždaroji akcinė bendrovė "LABOCHEMA"   30,80   
 547  2   O. Žuravliovo įmonė "AVSISTA"   60,24   
 548  1   Uždaroji akcinė bendrovė "LABOCHEMA"   21,24   
 548  2   O. Žuravliovo įmonė "AVSISTA"   23,44   
 550  1   O. Žuravliovo įmonė "AVSISTA"   27,06   
 551  1   Uždaroji akcinė bendrovė "SUVA"   60,00   
 551  2   UAB "Oriola–Vilnius"   90,00   
 551  3   Uždaroji akcinė bendrovė "LABOCHEMA"   88,50   
 551  4   O. Žuravliovo įmonė "AVSISTA"   149,52   
 551  5   Uždaroji akcinė bendrovė "Bioeksma"   184,08   
 552  1   O. Žuravliovo įmonė "AVSISTA"   74,80   
 552  2   Uždaroji akcinė bendrovė "Bioeksma"   139,24   
 553  1   UAB "Oriola–Vilnius"   194,70   
 554  1   Uždaroji akcinė bendrovė "SUVA"   33,20   
 554  2   O. Žuravliovo įmonė "AVSISTA"   44,40   
 554  3   Uždaroji akcinė bendrovė "Bioeksma"   136,88   
 555  1   Uždaroji akcinė bendrovė "SUVA"   56,80   
 555  2   O. Žuravliovo įmonė "AVSISTA"   59,00   
 555  3   Uždaroji akcinė bendrovė "LABOCHEMA"   103,84   
 555  4   Uždaroji akcinė bendrovė "Bioeksma"   177,00   
 556  1   Uždaroji akcinė bendrovė "SUVA"   118,96   
 556  2   O. Žuravliovo įmonė "AVSISTA"   193,04   
 556  3   Uždaroji akcinė bendrovė "LABOCHEMA"   245,44   
 556  4   Uždaroji akcinė bendrovė "Bioeksma"   269,04   
 557  1   Uždaroji akcinė bendrovė "SUVA"   185,04   
 557  2   Uždaroji akcinė bendrovė "Bioeksma"   311,52   
 557  3   O. Žuravliovo įmonė "AVSISTA"   332,68   
 557  4   Uždaroji akcinė bendrovė "LABOCHEMA"   405,92   
 558  1   UAB "Oriola–Vilnius"   15,75   
 558  2   Uždaroji akcinė bendrovė "Bioeksma"   40,12   
 558  3   UAB "BIOTECHA"   284,19   
 559  1   Uždaroji akcinė bendrovė "Bioeksma"   147,50   
 560  1   Uždaroji akcinė bendrovė "Bioeksma"   253,70   
 561  1   UAB "Oriola–Vilnius"   37,80   
 561  2   Uždaroji akcinė bendrovė "Bioeksma"   92,04   
 561  3   O. Žuravliovo įmonė "AVSISTA"   231,91   
 563  1   O. Žuravliovo įmonė "AVSISTA"   46,76   
 563  2   UAB "Oriola–Vilnius"   61,12   
 563  3   Uždaroji akcinė bendrovė "SUVA"   61,46   
 563  4   Uždaroji akcinė bendrovė "LABOCHEMA"   92,04   
 564  1   UAB "Oriola–Vilnius"   199,42   
 564  2   Uždaroji akcinė bendrovė "SUVA"   213,10   
 565  1   Uždaroji akcinė bendrovė "SUVA"   30,00   
 565  2   UAB "Oriola–Vilnius"   37,00   
 565  3   Uždaroji akcinė bendrovė "Bioeksma"   53,10   
 566  1   Uždaroji akcinė bendrovė "SUVA"   70,20   
 566  2   O. Žuravliovo įmonė "AVSISTA"   81,40   
 566  3   Uždaroji akcinė bendrovė "LABOCHEMA"   88,50   
 566  4   Uždaroji akcinė bendrovė "Bioeksma"   94,40   
 567  1   UAB "Oriola–Vilnius"   719,80   
 567  2   Uždaroji akcinė bendrovė "SUVA"   767,60   
 567  3   Uždaroji akcinė bendrovė "LABOCHEMA"   792,96   
 567  4   Uždaroji akcinė bendrovė "Bioeksma"   896,80   
 567  5   O. Žuravliovo įmonė "AVSISTA"   916,00   
 568  1   Uždaroji akcinė bendrovė "LABOCHEMA"   320,96   
 568  2   UAB "Oriola–Vilnius"   354,00   
 568  3   Uždaroji akcinė bendrovė "Bioeksma"   472,00   
 568  4   Uždaroji akcinė bendrovė "SUVA"   600,00   
 569  1   Uždaroji akcinė bendrovė "Bioeksma"   109,03   
 569  2   O. Žuravliovo įmonė "AVSISTA"   124,44   
 569  3   Uždaroji akcinė bendrovė "LABOCHEMA"   287,45   
 570  1   Uždaroji akcinė bendrovė "Bioeksma"   109,03   
 570  2   O. Žuravliovo įmonė "AVSISTA"   131,40   
 570  3   Uždaroji akcinė bendrovė "LABOCHEMA"   287,45   
 571  1   Uždaroji akcinė bendrovė "SUVA"   586,60   
 571  2   UAB "Oriola–Vilnius"   592,83   
 571  3   O. Žuravliovo įmonė "AVSISTA"   711,00   
 571  4   Uždaroji akcinė bendrovė "LABOCHEMA"   731,60   
 571  5   Uždaroji akcinė bendrovė "Bioeksma"   731,60   
 572  1   UAB "Oriola–Vilnius"   523,92   
 572  2   Uždaroji akcinė bendrovė "SUVA"   539,00   
 572  3   Uždaroji akcinė bendrovė "LABOCHEMA"   601,80   
 572  4   Uždaroji akcinė bendrovė "Bioeksma"   708,00   
 572  5   O. Žuravliovo įmonė "AVSISTA"   734,40   
 573  1   Uždaroji akcinė bendrovė "LABOCHEMA"   442,50   
 573  2   O. Žuravliovo įmonė "AVSISTA"   566,46   
 574  1   O. Žuravliovo įmonė "AVSISTA"   37,20   
 574  2   Uždaroji akcinė bendrovė "SUVA"   60,00   
 574  3   Uždaroji akcinė bendrovė "LABOCHEMA"   80,24   
 575  1   O. Žuravliovo įmonė "AVSISTA"   84,28   
 575  2   Uždaroji akcinė bendrovė "SUVA"   108,00   
 575  3   Uždaroji akcinė bendrovė "LABOCHEMA"   132,16   
 576  1   O. Žuravliovo įmonė "AVSISTA"   22,32   
 576  2   Uždaroji akcinė bendrovė "LABOCHEMA"   113,28   
 577  1   Uždaroji akcinė bendrovė "SUVA"   99,00   
 577  2   O. Žuravliovo įmonė "AVSISTA"   114,30   
 577  3   Uždaroji akcinė bendrovė "LABOCHEMA"   120,36   
 578  1   Uždaroji akcinė bendrovė "SUVA"   242,90   
 578  2   Uždaroji akcinė bendrovė "LABOCHEMA"   322,14   
 579  1   O. Žuravliovo įmonė "AVSISTA"   542,51   
 580  1   UAB "Oriola–Vilnius"   477,90   
 580  2   Uždaroji akcinė bendrovė "LOKMIS"   938,10   
 580  3   Uždaroji akcinė bendrovė "Bioeksma"   955,80   
 580  4   Uždaroji akcinė bendrovė "LABOCHEMA"   1.663,80   
 581  1   Uždaroji akcinė bendrovė "LOKMIS"   849,60   
 581  2   Uždaroji akcinė bendrovė "LABOCHEMA"   1.038,99   
 581  3   UAB "Oriola–Vilnius"   1.274,40   
 581  4   Uždaroji akcinė bendrovė "Bioeksma"   1.628,40   
 582  1   UAB "Oriola–Vilnius"   31,50   
 582  2   Uždaroji akcinė bendrovė "Bioeksma"   80,24   
 582  3   Uždaroji akcinė bendrovė "LABOCHEMA"   337,48   
 582  4   UAB "BIOTECHA"   568,38   
 583  1   UAB "Oriola–Vilnius"   25,20   
 583  2   Uždaroji akcinė bendrovė "Bioeksma"   61,36   
 583  3   O. Žuravliovo įmonė "AVSISTA"   80,36   
 583  4   Uždaroji akcinė bendrovė "LABOCHEMA"   328,04   
 583  5   UAB "BIOTECHA"   681,51   
 584  1   Uždaroji akcinė bendrovė "SUVA"   454,80   
 584  2   Uždaroji akcinė bendrovė "LABOCHEMA"   455,48   
 584  3   O. Žuravliovo įmonė "AVSISTA"   600,80   
 585  1   Uždaroji akcinė bendrovė "SUVA"   471,50   
 585  2   O. Žuravliovo įmonė "AVSISTA"   599,00   
 585  3   Uždaroji akcinė bendrovė "LABOCHEMA"   1.917,50   
 586  1   O. Žuravliovo įmonė "AVSISTA"   121,60   
 586  2   Uždaroji akcinė bendrovė "SUVA"   264,40   
 586  3   Uždaroji akcinė bendrovė "LABOCHEMA"   269,04   
 586  4   Uždaroji akcinė bendrovė "Bioeksma"   339,84   
 587  1   O. Žuravliovo įmonė "AVSISTA"   515,40   
 587  2   Uždaroji akcinė bendrovė "SUVA"   573,40   
 588  1   UAB "Oriola–Vilnius"   106,20   
 588  2   Uždaroji akcinė bendrovė "SUVA"   149,75   
 588  3   Uždaroji akcinė bendrovė "LABOCHEMA"   456,66   
 589  1   Uždaroji akcinė bendrovė "SUVA"   79,45   
 589  2   Uždaroji akcinė bendrovė "Bioeksma"   106,20   
 589  3   Uždaroji akcinė bendrovė "LABOCHEMA"   377,01   
 590  1   Uždaroji akcinė bendrovė "Bioeksma"   141,60   
 590  2   O. Žuravliovo įmonė "AVSISTA"   162,72   
 590  3   UAB "Oriola–Vilnius"   176,29   
 590  4   Uždaroji akcinė bendrovė "SUVA"   184,84   
 590  5   Uždaroji akcinė bendrovė "LABOCHEMA"   253,70   
 591  1   UAB "Oriola–Vilnius"   33,60   
 591  2   Uždaroji akcinė bendrovė "SUVA"   41,00   
 591  3   Uždaroji akcinė bendrovė "Bioeksma"   74,34   
 591  4   O. Žuravliovo įmonė "AVSISTA"   140,00   
 592  1   Uždaroji akcinė bendrovė "SUVA"   50,00   
 592  2   UAB "Oriola–Vilnius"   52,50   
 592  3   Uždaroji akcinė bendrovė "Bioeksma"   92,04   
 592  4   O. Žuravliovo įmonė "AVSISTA"   186,00   
 594  1   UAB "Oriola–Vilnius"   79,65   
 595  1   UAB "Oriola–Vilnius"   123,02   
 596  1   Uždaroji akcinė bendrovė "LABOCHEMA"   617,73   
 600  1   Uždaroji akcinė bendrovė "LOKMIS"   178,18   
 602  1   Uždaroji akcinė bendrovė "LABOCHEMA"   49,56   
 602  2   Uždaroji akcinė bendrovė "LOKMIS"   55,46   
 602  3   Uždaroji akcinė bendrovė "Bioeksma"   69,62   
 603  1   Uždaroji akcinė bendrovė "LOKMIS"   767,00   
 603  2   Uždaroji akcinė bendrovė "Bioeksma"   837,80   
 603  3   UAB "Oriola–Vilnius"   1.132,80   
 604  1   Uždaroji akcinė bendrovė "LOKMIS"   789,42   
 604  2   Uždaroji akcinė bendrovė "Bioeksma"   944,00   
 604  3   UAB "Oriola–Vilnius"   1.045,48   
 605  1   UAB "Oriola–Vilnius"   441,00   
 605  2   Uždaroji akcinė bendrovė "Bioeksma"   460,20   
 606  1   Uždaroji akcinė bendrovė "SUVA"   1.082,00   
 606  2   Uždaroji akcinė bendrovė "Bioeksma"   2.454,40   
 607  1   Uždaroji akcinė bendrovė "LABOCHEMA"   286,27   
 607  2   Uždaroji akcinė bendrovė "LOKMIS"   708,00   
 607  3   Uždaroji akcinė bendrovė "Bioeksma"   708,00   
 608  1   Uždaroji akcinė bendrovė "Bioeksma"   188,80   
 608  2   Uždaroji akcinė bendrovė "LABOCHEMA"   669,20   
 609  1   Uždaroji akcinė bendrovė "LOKMIS"   566,40   
 609  2   Uždaroji akcinė bendrovė "Bioeksma"   672,60   
 609  3   Uždaroji akcinė bendrovė "LABOCHEMA"   692,66   
 610  1   UAB "Oriola–Vilnius"   169,92   
 610  2   Uždaroji akcinė bendrovė "SUVA"   212,10   
 610  3   O. Žuravliovo įmonė "AVSISTA"   221,40   
 610  4   Uždaroji akcinė bendrovė "Bioeksma"   513,30   
 612  1   Uždaroji akcinė bendrovė "SUVA"   563,60   
 613  1   O. Žuravliovo įmonė "AVSISTA"   150,00   
 613  2   Uždaroji akcinė bendrovė "Bioeksma"   194,70   
 614  1   Uždaroji akcinė bendrovė "SUVA"   262,00   
 615  1   Uždaroji akcinė bendrovė "Bioeksma"   1.043,12   
 615  2   Uždaroji akcinė bendrovė "LABOCHEMA"   1.496,24   
 615  3   O. Žuravliovo įmonė "AVSISTA"   2.404,30   
 616  1   O. Žuravliovo įmonė "AVSISTA"   147,12   
 616  2   Uždaroji akcinė bendrovė "LABOCHEMA"   257,24   
 616  3   Uždaroji akcinė bendrovė "Bioeksma"   477,90   
 617  1   O. Žuravliovo įmonė "AVSISTA"   58,56   
 617  2   Uždaroji akcinė bendrovė "Bioeksma"   80,24   
 617  3   Uždaroji akcinė bendrovė "LABOCHEMA"   194,70   
 618  1   Uždaroji akcinė bendrovė "LABOCHEMA"   328,04   
 619  1   O. Žuravliovo įmonė "AVSISTA"   55,65   
 619  2   Uždaroji akcinė bendrovė "Bioeksma"   84,96   
 619  3   UAB "DIAMEDICA"   318,60   
 619  4   Uždaroji akcinė bendrovė "LABOCHEMA"   328,04   
 619  5   UAB 'Genomas'   332,29   
 620  1   Uždaroji akcinė bendrovė "LABOCHEMA"   17,70   
 620  2   Uždaroji akcinė bendrovė "Bioeksma"   42,48   
 620  3   O. Žuravliovo įmonė "AVSISTA"   102,28   
 621  1   Uždaroji akcinė bendrovė "Bioeksma"   672,60   
 621  2   Uždaroji akcinė bendrovė "LABOCHEMA"   722,16   
 621  3   UAB "DIAMEDICA"   2.655,00   
 621  4   O. Žuravliovo įmonė "AVSISTA"   3.649,05   
 622  1   Uždaroji akcinė bendrovė "LABOCHEMA"   594,72