tipinė forma
patvirtinta Viešųjų pirkimų tarnybos
prie Lietuvos Respublikos Vyriausybės
direktoriaus 2006 m. sausio 19 d. įsakymu Nr. 1S-4
(Viešųjų pirkimų tarnybos direktoriaus 2011 m.
liepos d. įsakymo Nr. 1S- redakcija)
S
p
a
u
d
a
s
Pildo VPT darbuotojas


Nacionalinė visuomenės sveikatos priežiūros laboratorija
(Perkančiosios organizacijos pavadinimas)
 
Juridinių asmenų registras, 195551983, Žolyno g. 36, 10210 Vilnius, Tel.: (8 5) 270 9229, Faks.: (8 5) 210 4848, nvstc@nvstc.lt, www.nvstc.lt
 
Viešųjų pirkimų tarnybai  
 
 

20    m.                        d. Nr.      

I. BENDRA INFORMACIJA APIE PIRKIMĄ
I. PIRKIMO NUMERIS
59979   
2. AR PIRKIMAS YRA SUSIJĘS SU PROJEKTU IR/ARBA PROGRAMA,
FINANSUOJAMA EUROPOS SĄJUNGOS LĖŠOMIS?  
  TAIP          NE  
3. AR PIRKIMAS ATLIEKAMAS CENTRINĖS VIEŠŲJŲ PIRKIMŲ
INFORMACINĖS SISTEMOS PRIEMONĖMIS? 

(kaip numatyta Viešųjų pirkimų įstatymo 151 straipsnyje, elektroninis pirkimas)
  TAIP          NE  
II. PERKANČIOJI ORGANIZACIJA
1. PERKANČIOSIOS ORGANIZACIJOS TIPO KODAS  1

2. AR PIRKIMO ĮGALIOJIMAI BUVO SUTEIKTI KITAI PERKANČIAJAI ORGANIZACIJAI?
(jeigu taip, pildyti 2.1 papunktį)
  TAIP          NE  
2.1. Įgaliotosios organizacijos pavadinimas, kodas, adresas ir tipas

Pavadinimas
 
Kodas
   
Adresas, telefonas
  
Organizacijos tipo kodas
   

III. PIRKIMO OBJEKTAS

1. AR ŠIS PIRKIMAS ATLIEKAMAS SIEKIANT SUDARYTI PRELIMINARĄJĄ PIRKIMO SUTARTĮ   TAIP          NE  

2. PREKIŲ PIRKIMO TIPAS     (pažymimas tik vienas iš langelių)
Pirkimas Nuoma Lizingas Pirkimas išsimokėtinai Mišrus
3. PASLAUGŲ KATEGORIJA
      ( pagal Viešųjų pirkimų įstatymo 2 priedėlį ) 
4. DARBŲ TIPAS     (pažymimas tik vienas iš langelių)
Atlikti darbus Atlikti ir suprojektuoti darbus Bet kokiomis priemonėmis atlikti darbus, atitinkankčius
perkančiosios organizacijos nustatytus reikalavimus
5. PIRKIMO OBJEKTO PAVADINIMAS
Medikamentų, reagentų, diagnostikumų, mitybinių terpių ir kitų laboratorinių priemonių pirkimas 
6. PAGRINDINIS PIRKIMO OBJEKTO KODAS PAGAL BVPŽ
  24641250-6
7. PAPILDOMI PIRKIMO OBJEKTO KODAI PAGAL BVPŽ (jei yra)
  25240000-5
33141625-7
24496500-2
24494000-3
36712000-5
26152330-0
33124110-9
36731000-4
24147000-6
27520000-6
26131100-6
33190000-8
24135000-9
26152339-3
24133120-2
24144100-6
24133400-9
24141300-7
25224000-7
25221000-6
24110000-8
25200000-3
24141100-5
24111160-4
24111150-1
24111131-2
24111120-2
21122200-6
25161200-9
33251200-6
33152000-0
28212100-2
18143000-3
24131000-1
24122400-9
24132120-5
24131411-5
24100000-5
17221000-7
24131470-6
24142200-3
24143210-3
24142400-5
24250000-1
24800000-2
24710000-4
24498100-2
24495000-0
24496300-0
25212210-5
33244000-2
33196000-0
33141115-9
33141320-9
27110000-9
18133000-0
24135300-2
24134100-3
01111200-0
01113100-3
22500000-5
24121000-8
24131520-2
25100000-2
26132000-2
33169000-2
24133220-3
24132220-6
24131130-1
24131420-1
24133100-6
24133110-9
24132210-3
33500000-5
33141114-2
27521500-8
26241300-2
24142210-6
24142310-7
24146000-9
24146100-0
24144000-5
24146320-8
24151100-8
24641000-9
24131410-8
24141220-2
24141221-9
33141411-4
29122230-1
26200000-0
28611200-0
33141420-0
36673200-1
36712200-7
24131522-6
24133124-0
24133121-9
24133310-1
24141110-8
24141120-1
24141223-3
24141224-0
24143200-0
24145000-2
25213000-7
26131300-8
33141310-6
24132100-9
24133300-8
24135210-4
24141222-6
24137000-3
24141225-7
24142510-9
24151320-6
26100000-9
33141110-4
24131600-7
24132122-9
24133320-4
24133126-4
24135700-6
17225800-3
24142300-4
24144400-9
24143400-2
24151330-9
29852340-1
24133123-3
24493000-6
33141623-3
24111320-4

8. PIRKIMO OBJEKTO DALYS, DĖL KURIŲ TIEKĖJAI BUVO PRAŠOMI PATEIKTI ATSKIRUS PASIŪLYMUS
(pildyti, jeigu pirkimo objektas skirstomas į dalis)
Pirkimo objekto dalies numeris Pavadinimas Pirkimo objekto kodas pagal BVPŽ
1 Rinkinys tirpaus Legionella antigeno aptikimui šlapime 33141625-7
2 Lateksinis testas Staphytect Plus 33141625-7
3 Lateksinis testas PBP'2 baltymui 33141625-7
4 Testas Beta-laktamazių aktyvumo nustatymui - Nitrocephin (cefinazė) 33141625-7
5 PYR testas 33141625-7
6 Pneumokokų lateks agliutinacijos rinkinys (diagnostikai 33141625-7
7 Antiserumų rinkinys S.pneumoniae serotipavimui latex agliutinacijos metodu 24496500-2
8 Imunochromatografinis testas antigeno E.coli 0157 nustatymui išmatuose 33141625-7
9 Roto virusų nustatymo išmatose diagnostikumas 33141625-7
10 Astro virusų nustatymo išmatose diagnostikumas 33141625-7
11 Noro virusų nustatymo išmatose diagnostikumas 33141625-7
12 Adeno virusų testas 33141625-7
13 H.influenzae b antigeno nustatymas tiesiogiai iš organizmo skysčių 33141625-7
14 N. meningitidis antigeno nustatymas tiesiogiai iš organizmo skysčių 33141625-7
15 Legionelių agliutinaciniai serumai 33141625-7
16 Streptokokų nustatymo rinkiniai 33141625-7
17 Chlamydia trachomatis IF diagnostinis rinkinys ir priemonės 33141625-7
18 Chlamydia trachomatis TIF diagnostinis rinkinys ir priemonės 33141625-7
19 Etaloninės padermės 24498100-2
20 D-Tartratas 24498100-2
21 Difterijos antitoksinis serumas 24496500-2
22 Geležies chlorido reagentas 24496500-2
23 Imunomagnetinės dalelės su E.coli O157 antikūnais 33141625-7
24 Imersinis aliejus 24496500-2
25 Imersinis aliejus (fluorescencijai) TYPE DF 24496500-2
26 Kalio hidroksido reagentas 24496500-2
27 Kovačio reagentas 24496500-2
28 Liofilizuota triušio plazma 24496500-2
29 McFARLAND standartų rinkinys 1x5 24496500-2
30 Mukatinė rūgštis 24496500-2
31 Neslerio reagentas 24100000-5
32 Oksidazės reagentas 24496500-2
33 Ph-metro Knick (ph tirpalų rinkinys) 24100000-5
34 Tulžies tirpumo reagentas 2% (2% dezoksicholatas) 24496500-2
35 Voges-Proskauer A reagentas 24496500-2
36 Voges-Proskauer B reagentas 24496500-2
37 Arabinozė stestas 24496500-2
38 Arginino testas 24496500-2
39 Gliukozės testas 24496500-2
40 Ksilozės testas 24496500-2
41 Laktozės testas 24496500-2
42 Maltozės testas 24496500-2
43 Ornitino testas 24496500-2
44 Ramnozės testas 24496500-2
45 Sacharozės testas 24496500-2
46 Sorbito testas 24496500-2
47 Biologiniai indikatoriai drėgnojo sterilizavimo įrangos biologinei kontrolei su Geobacillus stearothermophilus sporomis 33141625-7
48 Biologiniai indikatoriai karšto oro sterilizavimo įrangos biologinei kontrolei su Bacillus atrophaeus sporomis 33141625-7
49 Cheminiai indikatoriai (juosta) drėgnojo sterilizavimo įrangos proceso kontrolei 24800000-2
50 Cheminiai indikatoriai (lipdukai) sterilizacijai karštu oru 24800000-2
51 Faktoriai hemofilų identifikavimui 24496500-2
52 Atmosferos sąlygų sudarymo sistemos 24496500-2
53 Mikroorganizmų jautrumo antibiotikams sistemos 33141625-7
54 Greitos identifikacinės sistemos 33141625-7
55 Plokštelė mielių grybų identifikavimui ir jautrumui priešgrybiniams vaistams nustatyti 33141625-7
56 Mycoplasma pneumoniae identifikavimo rinkinys 33141625-7
57 Mycoplasma hominis ir Ureaplasma urealyticum identifikavimo diagnostinis rinkinys antigeno nustatymui 33141625-7
58 Mini API identifikavimo plokštelės ir reagentai 33141625-7
59 Novobiocinas 5 µg 24496500-2
60 Furazolidonas 100 µg 24496500-2
61 Kolistinas 10 µg 24496500-2
62 Vankomicinas 5 µg 24496500-2
63 Kanamicinas 1000 µg 24496500-2
64 Penicilinas 2 VV 24496500-2
65 SPS diskai 24496500-2
66 Adonito diskai 24496500-2
67 Bacitracino diskai 24496500-2
68 Dulcito diskai 24496500-2
69 Indoxyl acetato diskai 24496500-2
70 Inozito diskai 24496500-2
71 Melibiozės diskai 24496500-2
72 Moraxella catarrhalis diskai 24496500-2
73 Optochino diskai 24496500-2
74 ONPG diskai 24496500-2
75 Rafinozės diskai 24496500-2
76 Tregalozės diskai 24496500-2
77 Tulžies diskai 24496500-2
78 Antibiotikų diskai antimikrobiniam jautrumui nustatyti (Oxoid paskirstytojams) 24494000-3
79 Antibiotikų diskai antimikrobiniam jautrumui nustatyti (Becton Dickenson paskirstytojams) 24494000-3
80 E-testai (Benzylpenicilinas, Ceftazidimas, Cefotaksimas, Vankomicinas) 24494000-3
81 S. pneumoniae minimalios koncentracijos nustatymas 24494000-3
82 Salmonella A-G grupių bakterijų bakteriofagas 24494000-3
83 Shigella polivalentinis bakteriofagas 24494000-3
84 Shigella antiserumai 24496500-2
85 Yersinia enterocolitica monovalentiniai agliutinaciniai serumai 24496500-2
86 Yersinia pseudotuberculosis agliutinaciniai monovalentiniai serumai 24496500-2
87 Escherichia coli antiserumai 24496500-2
88 Salmonella polivalentiniai antiserumai 24496500-2
89 Salmonella monovalentiniai antiserumai 24496500-2
90 Salmonella agliutinaciniai serumai pagal Sven Gard 24496500-2
91 Dažų rinkinys dažymui Gramo būdu, 4x250 ml 24122400-9
92 Gramo dažų sudėtinė dalis Liugolis, 1000 ml 24122400-9
93 Gramo dažų sudėtinė dalis Blankintojas, 1000 ml 24122400-9
94 DIAGNOSTIKUMAI IR REAGENTAI MOLEKULINEI BIOLOGIJAI 33124110-9
95 HotStart - Taq DNR polimerazė 24496500-2
96 100 bp DNR žymuo 24496500-2
97 2mM dNTP Mix 24496500-2
98 Oligonukleotidų pradmuo EM-H15: 5' CCATATTACAACAATATTCCTATC 3' 24496500-2
99 Oligonukleotidų pradmuo EM-H17: 5' GTGAGTGATTCTTGTTAGGGGAAG 3' 24496500-2
100 Oligonukleotidų pradmuo Cest4: 5' GTTTTTGTGTGTTACATTAATAAGGGTG 3' 24496500-2
101 Oligonukleotidų pradmuo Cest5: 5' GCGGTGTGTACMTGAGCTAAAC 3' 24496500-2
102 Oligonukleotidinis pradmuo mecA-1: 5’- GCA ATC GCT AAA GAA CTA AG 24496500-2
103 Oligonukleotidinis pradmuo mecA-2: 5’- GGG ACC AAC ATA ACC TAA TA 24496500-2
104 Oligonukleotidinis pradmuo nuc-1: 5’-GCG ATT GAT GGT GAT ACG GTT 24496500-2
105 Oligonukleotidinis pradmuo nuc-2: 5’-AGC CAA GCC TTG ACG AAC TAA AGC 24496500-2
106 Oligonukleotidų pradmuo C.d. 1: 5' ATC CAC TTT TAG TGC GAG AAC CTT CGT CA-3' 24496500-2
107 Oligonukleotidų pradmuo C.d. 2: 5' GAA AAC TTT TCT TCG TAC CAC GGG ACT AA-3' 24496500-2
108 Rinkinys genominės DNR išskyrimui 24496500-2
109 Taq DNR polimerazė 24496500-2
110 Vanduo molekulinei biologijai 24496500-2
111 Genetiškai modifikuota soja (0,1%) 01113100-3
112 Genetiškai modifikuota soja (0,5%) 01113100-3
113 Genetiškai modifikuoti kukurūzai MON810 (0,1%) 01111200-0
114 Genetiškai modifikuoti kukurūzai MON810 (0,5%) 01111200-0
115 0,2 ml PGR mėgintuvėliai 25240000-5
116 0,5 ml PGR mėgintuvėliai 25240000-5
117 1,5 ml mikrocentrifuginiai mėgintuvėliai 25240000-5
118 2,0 ml mikrocentrifuginiai mėgintuvėliai 25240000-5
119 Analitinės šukos gelio elektroforezei,11 dantukų (3x1mm) 25240000-5
120 Antgaliai automatinėms pipetėms 0,1-10 µl, su filtru 25240000-5
121 Antgaliai automatinėms pipetėms 0,1-2,5 µl, su filtru 25240000-5
122 Antgaliai automatinėms pipetėms 100 µl, su filtru 25240000-5
123 Antgaliai automatinėms pipetėms 200 µl, su filtru 25240000-5
124 Antgaliai automatinėms pipetėms, 1000µl 25240000-5
125 Antgaliai automatinėms pipetėms, 100µl 25240000-5
126 Stiklinė kolba, 250ml 26152330-0
127 Laboratorinė šluostė 17225800-3
128 Pirštinės nitrilinės S ir M dydžio 25161200-9
129 Buferis elektroforezei TAE 50x 24496300-0
130 Vandenilio peroksidas 30 % 24496300-0
131 Reagentų įpurškimo flakonas 25240000-5
132 PREKĖS EDEN PROJEKTUI 25240000-5
133 LABORATORINĖS PRIEMONĖS Whatman membraninei filtravimo sistemai 25240000-5
134 Petri lėkštelės, 90x14 mm 25240000-5
135 Pastero pipetės, sterilios, 1- 3 ml, su rezervuaru pipetės viršuje, supakuotos po 1 25240000-5
136 Pipetės, 1 ml 25240000-5
137 Pipetės, 10 ml 25240000-5
138 Pipetės, 10 ml, supakuotos po 1 25240000-5
139 Kilpelės, 1 µl 25240000-5
140 Kilpelės, 10 µl 25240000-5
141 Švirkštai su adata, sterilūs, 2 ml, su adata 33141310-6
142 Tamponai plastikiniai, sterilūs 25240000-5
143 Homogenizavimo maišai, 400 ml 25240000-5
144 Homogenizavimo maišai su tinkleliu, 400 ml 25240000-5
145 Autoklavavimo maišai, 50x75 cm, tūris 60 litrų 25240000-5
146 Autoklavavimo maišai, tūris 30 litrų 25240000-5
147 Antgaliai Finntip, 250 µl 25240000-5
148 Antgaliai Finntip, 1000 µl 25240000-5
149 Antgaliai Stepper, 1,25 ml 25240000-5
150 Antgaliai Stepper, 12,5 ml 25240000-5
151 Antgaliai Socorex, 100 µl 25240000-5
152 Antgaliai automatinei mini API pipetei "Embouts ATB" 25240000-5
153 Dėžutės kriomėgintuvėliams mikroorganizmų bankui 40-80 vietų 25240000-5
154 Stovai plastikiniai, monolitiniai, 10 vietų, homogenizavimo maišams 25240000-5
155 Krepšeliai polipropileniniai 156x168x178 h/mm 25240000-5
156 Anaerostatas su lėkštelių laikikliu, 2,5 l 25240000-5
157 Antibiotikų diskų paskirstytojas (dispenseris) 33190000-8
158 Stovai mėgintuvėliams S formos, 243x126x64 25240000-5
159 Stovai mėgintuvėliams S formos, 225x114x60 25240000-5
160 Stovai mėgintuvėliams, 246x101x70 25240000-5
161 Stovai mėgintuvėliams, tinkami sterilizavimui 180oC 27520000-6
162 Marlė medicininė, 20 m x 90 cm 33141114-2
163 Tvarstis nesterilus, 7 m x 14 cm 33141110-4
164 Vata medicininė, chirurginė, 100% medvilnės 33141115-9
165 Žirklės buitinės, 18 cm 28611200-0
166 Skalpeliai anatominiai, 35 mm 33141411-4
167 Pincetai nerūdijančio plieno, 14,5 cm 33169000-2
168 Pincetai nerūdijančio plieno, 20 cm 33169000-2
169 Pincetai nerūdijančio plieno membraninio filtro paėmimui 33169000-2
170 Filtrai membraniniai 0,22 µm, balti 33169000-2
171 Filtrai membraniniai 0,45 µm, balti 36712000-5
172 Filtrai membraniniai 0,45 µm, pilki 36712000-5
173 Pludės (Durham) vamzdeliai) stikliniai 26152330-0
174 Objektiniai stikleliai mikroskopavimui, 76x26 mm 26152330-0
175 Dengiamieji stikleliai, 24x24 mm 26152330-0
176 Dengiamieji stikleliai, 18x18 mm 26152330-0
177 Mėgintuvėliai stikliniai 150x16x0,6-0,7 mm 26152339-3
178 Gaubteliai tinkantys mėgintuvėliams 16 mm diametro 27520000-6
179 Mėgintuvėliai stikliniai 180x18x0,7-0,8 mm 26152339-3
180 Gaubteliai tinkantys mėgintuvėliams 18 mm diametro 27520000-6
181 Mėgintuvėliai stikliniai 180x20 mm 26152339-3 26152339-3
182 Gaubteliai tinkantys mėgintuvėliams 20 mm diametro 27520000-6
183 Mėgintuvėliai stikliniai 100 x13 mm 26152339-3
184 Gaubteliai tinkantys mėgintuvėliams 13 mm diametro 27520000-6
185 Krio mėgintuvėliai, 1,2x3,8 cm 25240000-5
186 Spiritinė lemputė, 250 ml 26152330-0
187 Laboratorinis stiklinis indas nukenksminimui, 2000 ml, 13-15 cm diametro 26152330-0
188 Laboratorinis stiklinis indas nukenksminimui, 5000 ml, 15x40 cm 26152330-0
189 Spausdinimo juostelė, tinkama prietaisui miniAPI (Cal. Ribbons GR 24 purple nylon 1024 FN) 22500000-5
190 Lęšių popierius mikroskopų objektyvų valymui 21122200-6
191 Filtrinis popierius 21122200-6
192 Medicininis krepuotas popierius 21122200-6
193 Laboratorinė plėvelė Parafilm "M" 25240000-5
194 Pirštinės sterilios, M dydžio 33141420-0
195 Dezinfekuojančios servetėlės 24250000-1 24250000-1
196 Guminės kriaušės skysčių siurbimui 25100000-2
197 Pipetavimo įrenginys, plastikinis, iki 2 ml stiklinėms arba plastikinėms pipetėms 29122230-1
198 Pipetavimo įrenginys, plastikinis, 10 ml stiklinėms arba plastikinėms pipetėms 29122230-1
199 Respiratorius darbui prie autoklavo 18143000-3
200 Apsauginiai akiniai darbui prie auklavo 18143000-3
201 Prijuostė polietileninė 81x164 25240000-5
202 Pirštinės buitinės 25161200-9
203 Vežimėliai instrumentiniai laboratoriniai 33190000-8
204 Taimeriai laboratoriniai elektroniniai 33500000-5
205 Termometrai laboratoriniai TL-4 (0 - 50):0,1 33251200-6
206 Termometrai laboratoriniai TL-4 (50-104):0,1 33251200-6
207 Termometrai laboratoriniai SP-77 (-5 - 75):0,5 33251200-6
208 Termometrai laboratoriniai , spiritiniai TS-7A (-10 - 60):1,0 33251200-6
209 Termometrai laboratoriniai , spiritiniai TP-22 (-30 - 30):0,5 33251200-6
210 Termometrai laboratoriniai, maksimalūs SP-82 (20 - 150):1,0 33251200-6
211 Termometrai laboratoriniai, maksimalūs SP-83 (20 - 220):1,0 33251200-6
212 Acetatinis agaras 24641250-6
213 Agaras Nr.1 24641250-6
214 Listerijų agaras (ALOA) su priedu 24641250-6
215 Baird-Parker terpė su priedu 24641250-6
216 Bakteriologinis peptonas neutralus 24641250-6
217 B.cereus agaras su priedu 24641250-6
218 Boltono sultinys su priedu 24641250-6
219 Brilijantinės žalumos agaras 24641250-6
220 Brilijantinės žalumos tulžies sultinys 2% 24641250-6
221 Buferinis peptono vanduo 24641250-6
222 Cary - Blair terpė (transportinė) 24641250-6
223 Jersinijų atranki terpė su priedu 24641250-6
224 Chju -Leifsono terpė 24641250-6
225 Candida chromogeninis agaras 24641250-6
226 CLED agaras 24641250-6
227 Dermasel agaras 24641250-6
228 Dermatofitų tyrimo agaras 24641250-6
229 Dezoksicholato citrato agaras 24641250-6
230 DNR agaras 24641250-6
231 Druskos polimiksino B buljonas vibrionams 24641250-6
232 EE sultinys 24641250-6
233 EC sultinys 24641250-6
234 Endo terpė 24641250-6
235 Izo sensi test agaras 24641250-6
236 Fenilalanino agaras 24641250-6
237 Fenolio raudonio agaro pagrindas 24641250-6
238 Fenolo raudonojo sultinys 24641250-6
239 Fenolo raudonojo manito agaras 24641250-6
240 Listerijų auginimo sultinys su priedu 24641250-6
241 Geležies sulfito agaras 24641250-6
242 Haemophilus test agaras su priedu 24641250-6
243 Hektoen Enteric agaras 24641250-6
244 Kampilobakterijų atranki terpė su priedu 24641250-6
245 Kukurūzų miltų agaras 24641250-6
246 Kraujo agaro pagrindas Nr.2 24641250-6
247 Kolumbijos agaras 24641250-6
248 Kazeino anglies agaras 24641250-6
249 Priedas kazeino anglies agarui 24641250-6
250 Laurylsulfato sultinys 24641250-6
251 Laktozės sultinys 24641250-6
252 Legionella auginimo terpė su priedais 24641250-6
253 Leptospirų gausinimo priedas EMJH 24641250-6
254 Levino eosin-metileno mėlyno agaras 24641250-6
255 Listerijų atrankus agaras (OXFORD) su priedu 24641250-6
256 Listerijų atrankus agaras (PALCAM) su priedu 24641250-6
257 Lizino dekarboksilazės sultinys (Tailoro modifikacija) 24641250-6
258 Lizino geležies agaras 24641250-6
259 MacConkey agaras 24641250-6
260 MacConkey agaras Nr 3 24641250-6
261 MacConkey agaras su sorbitu 24641250-6
262 MacConkey sultinys 24641250-6
263 Manito druskos agaras 24641250-6
264 Malonato sultinys 24641250-6
265 mEnterokokų agaras (Slanetz Bartley) 24641250-6
266 Mielių ekstrakto agaras vandeniui tirti (Water plate count agar) 24641250-6
267 Mielių ekstrakto agaras su chloramfenikoliu 24641250-6
268 Mitybinis agaras 24641250-6
269 Mitybinis sultinys Nr1 24641250-6
270 Mitybinis sultinys Nr2 24641250-6
271 MRS agaras laktobakterijoms 24641250-6
272 MRS sultinys 24641250-6
273 MRVP sultinys 24641250-6
274 Modifikuotas gliutamato sultinys 24641250-6
275 Natrio glutamatas 24641250-6
276 Mueller-Hinton agaras 24641250-6
277 Mueller-Kauffmann tetrationato-novobiocino sultinys su priedu mišinyje 24641250-6
278 Peptono vanduo 24641250-6
279 Perfringens TSC terpė su priedu 24641250-6
280 Pseudomonų auginimo terpė su priedu 24641250-6
281 Pomidorų sulčių agaras 24641250-6
282 Rappaport-Vassiliadis sultinys 24641250-6
283 Ringerio tabletės 24641250-6
284 Saburo terpė su priedu 24641250-6
285 Saburo sultinys 24641250-6
286 Salyklo ekstrakto agaras 24641250-6
287 Salmonelių-šigelių agaras 24641250-6
288 Schaedler anaerobų agaras 24641250-6
289 Selenito sultinys su cistinu 24641250-6
290 Simonso citrato agaras 24641250-6
291 Standartinių metodų agaras 24641250-6
292 Standartinių metodų agaras su pienu 24641250-6
293 Streptokokų agaro priedas 24641250-6
294 Šarminis peptono vanduo 24641250-6
295 Širdies-smegenų ekstrakto agaras 24641250-6
296 Širdies-smegenų ekstrakto sultinys 24641250-6
297 Šlapalo agaras 24641250-6
298 TBX agaras 24641250-6
299 Tioglikolio sultinys 24641250-6
300 Tioglikolinė terpė USP 24641250-6
301 Tergitolio 7 agaras 24641250-6
302 TTC 0,125 % tirpalas 24641250-6
303 Terpė mikroorganizmų judrumui nustatyti 24641250-6
304 Tinsdalio agaras 24641250-6
305 Trijų cukrų geležies agaras 24641250-6
306 Triptono sojos agaras 24641250-6
307 Triptono sojos sultinys 24641250-6
308 Triptono vanduo 24641250-6
309 Tod Hiuvit sultinys 24641250-6
310 Tulžies eskulino azido agaras 24641250-6
311 Violetiniai raudono-tulžies-gliukozės agaras 24641250-6
312 Violetiniai raudono-tulžies-laktozės agaras 24641250-6
313 XLD agaras 24641250-6
314 Anaerobų auginimo terpė su priedu 24641250-6
315 Arabinozė-L(+) 24641250-6
316 Argininas-L 24641250-6
317 Arklio serumas sterilus 24641250-6
318 Bromtimolio mėlis 24641250-6
319 Cistinas-L 24641250-6
320 Citrinų rūgštis 24641250-6
321 Defibrinuotas arklio kraujas 24641250-6
322 Defibrinuotas arklio kraujas 24641250-6
323 Defibrinuotas avies kraujas 24641250-6
324 Dekstrozė 24641250-6
325 Fruktozė 24641250-6
326 Fuksinas 24641250-6
327 Galaktozė-D(+) 24641250-6
328 Glicerinas 24641250-6
329 Inozitas 24641250-6
330 Jodo milteliai 24641250-6
331 (L)Histidinohidrochloridas (monohid.) 24641250-6
332 Kalio hidrofosfatas(K2HPO4) 24641250-6
333 Kalio dihidrofosfatas(KH2PO4) 24641250-6
334 Kiaušinio lecitinas 24641250-6
335 Krakmolas tirpus 24641250-6
336 Ksilozė-D(+) 24641250-6
337 Laktozė 24641250-6
338 Maltozė 24641250-6
339 Natrio chloridas 24641250-6
340 Natrio hidrofosfato dihidratas(Na2HPO4x2H2O) 24641250-6
341 Natrio dihidrofosfatas (NaH2PO4) 24641250-6
342 Natrio sulfitas 24641250-6
343 Natrio hidroksidas 24641250-6
344 Natrio tiosulfatas(Na2S2O3) 24641250-6
345 Natrio azidas 24641250-6
346 Ornitinomonohidrochloridas-L 24641250-6
347 Polisorbatas 80 (Tween 80) 24641250-6
348 Ramnozė 24641250-6
349 Sacharozė 24641250-6
350 Salicinas-D 24641250-6
351 Urea (šlapalas) 24641250-6
352 Urea 40% 24641250-6
353 Chloramfenikolis 24641250-6
354 Trehalozė-D(+) 24641250-6
355 Petri lėkštelės 90-92mm 25240000-5
356 Petri lėkštelės 55-60mm 25240000-5
357 Kontaktinės lėkštelės 25240000-5
358 Dezinfekcinė medžiaga 24250000-1
359 Pakavimo maišai 24250000-1
360 Piltuvėliai stikliniai 25221000-6
361 Piltuvėliai plastkiniai 26152330-0
362 Cilindrai plastkiniai 10ml 25200000-3
363 Filtrai švirkštų srerilūs 0,22m/µ 36712000-5
364 Stikliniai cilindrai 10ml 26152330-0
365 Stikliniai cilindrai 50ml 26152330-0
366 Stikliniai cilindrai 100ml 26152330-0
367 Stikliniai cilindrai 500ml 26152330-0
368 Stikliniai cilindrai 1000ml 26152330-0
369 Dujų balionėliai 28212100-2
370 Chirurginės veido kaukės 18143000-3
371 Aliuminio folija 27521500-8
372 Kraujo sterilumui paėmimo sistema SIGNAL 33124110-9
373 Kultūretės su Stiuarto terpė mėginių paėmimui 24494000-3
374 Kultūretės su Amies terpe mėginių paėmimui, su anglimi 24494000-3
375 Kultūretė su Cary Blair terpė mėginių paėmimui 24494000-3
376 Tamponai su Dakronu 25240000-5
377 Tamponai plastikiniai su vata 25240000-5
378 Tamponai pavalymui (medis + vata) 33196000-0
379 Tamponai uretriniai (aliuminis+ vata) 33196000-0
380 Cervikaliniai šepetėliai 25240000-5
381 Liežuvio prispaudėjai 33196000-0
382 Indeliai šlapimui, sterilūs 25240000-5
383 Indeliai, išmatoms, sterilūs 25240000-5
384 Indeliai išmatoms 25240000-5
385 Maišai mėginių paėmimui 1,5 l. talpos 25221000-6
386 Sterilūs tamponėliai mėgintuvėliuose plovinių paėmimui 25240000-5
387 Kraujo ėmimo sistemos 25240000-5
388 Adatos 33141320-9
389 Kraujo ėmimo sistemos 25240000-5
390 Kraujo ėmimo sistemos 25240000-5
391 Adatos 33141320-9
392 Pirštinės vienkartinės nitrilinės S, M, L dydžio 33141320-9
393 Pirštinės vienkartinės lateksinės 33141320-9
394 Buteliai 500 ml 33141320-9
395 Buteliai 1000 ml 33141320-9
396 Buteliai vandens paėmimui 500 ml 25224000-7
397 Buteliai vandens paėmimui 1000 ml 25224000-7
398 Buteliai vandens paėmimui su natrio tiosulfatu 250 ml 25224000-7
399 Agar Strip TC 24495000-0
400 Agar Strip YM 24495000-0
401 Makšties skėtikliai 25240000-5
402 Procedūrų pagalvelės 33196000-0
403 Varžtis 33196000-0
404 Vienkartinės kaukės 18143000-3
405 Vienkartinis chalatas 18133000-0
406 Teleskopinė lazda 33244000-2
407 Stiklinė Pendulum 33244000-2
408 Kaukė 33244000-2
409 Filtras kaukei 18143000-3
410 Pirmosios pagalbos vaistinėlė su pirmosios pagalbos suteikimo priemonėmis ir vaistais 24493000-6
411 Vaistinelės 33141623-3
412 Izoterminis krepšys (šaldymo dėžė) 17221000-7
413 1- naftilaminas 24144100-6
414 1,10-fenantrolino chlorido monohidratas 24147000-6
415 1,5-difenilkarbazidas 24147000-6
416 1-butanolis 24142200-3
417 1-propanolis 24142200-3
418 2,6 dimetilfenolis 24142400-5 24142400-5
419 2-butanolis 24142200-3
420 2-Propanolio standartas tabako analizei 24142200-3
421 2-propanolis 24142200-3
422 4-amino antipirinas 24144100-6
423 4-dimetilamino benzaldehidas 24144100-6
424 4-fluorfenolis 24142400-5
425 Acetonas 24146000-9
426 Acetonitrilas 24147000-6 24146000-9
427 Acetonitrilas 24147000-6
428 Acto rūgštis 24143210-3
429 Acto rūgštis (HPLC) 24143210-3
430 Acto rūgštis, ledinė 24143210-3
431 Acto rūgštis (HPLC) 24143210-3
432 Akroleinas 24146100-0
433 Alavo dichloridas, dihidratas 24132120-5
434 Aliuminio oksidas 24121000-8
435 Aliuminio oksidas chromatografijai 24121000-8
436 Aliuminio sulfatas su 18 mol. vandens 24133123-3
437 Alizarino geltonasis 24147000-6
438 Alizarino S (C19H15O8 ) 24147000-6
439 Amidopirinas 24144000-5
440 Amonio acetatas 24147000-6
441 Amonio chloridas 24151320-6
442 Amonio geležies (III )alūnas 24133120-2
443 Amonio geležies sulfatas 6H2O (Moro druska) 24133120-2
444 Amonio hidroksidas 24121000-8
445 Amonio karbonatas 24133300-8
446 Amonio molibdatas, tetrahidratas 24135000-9
447 Amonio oksalatas 24147000-6
448 Amonio persulfatas 24133120-2
449 Amonio sulfatas 24133120-2
450 Amonio vanadatas 24135000-9
451 Anglies disulfidas 99,9 % 24133110-9
452 Antracenas 24141220-2
453 Arseno oksidas 24121000-8
454 Askorbo rūgštis 24147000-6
455 Azoto rūgštis 24151100-8
456 Azoto rūgštis (AAS) 24151100-8
457 Azūras A 24147000-6
458 Barbitūrinė rūgštis 24147000-6
459 Bario chloridas, dihidratas 24132120-5
460 Bario difenilamino sulfonatas 24144100-6
461 Benzoinė rūgštis 24143400-2
462 b-glicerofosfatas 24147000-6
463 Boro rūgštis 24131410-8
464 Bromkrezolio žaliasis 24147000-6
465 Bromtimolio mėlis 24147000-6
466 Butilacetatas 24147000-6
467 CDTA (trans-1,2-diaminociklo heksan - N,N,N’,N’-tetracto rūgšties monohidratas) 24144100-6 24147000-6
468 Cezio chloridas 24132120-5
469 Chloraminas-T (C7H7ClNNaO2S×3H2O) 24144100-6
470 Chlordane (technical) 24147000-6
471 Chloroformas 24141300-7
472 Cikloheksanas 24141120-1
473 Cinko acetatas, dihidratas 24147000-6
474 Cinko granulės be arseno 24135000-9
475 Cinko sulfatas, heptahidratas 24133120-2
476 Citrinos rūgštis 24147000-6
477 Deguonies nulins tirpalas 24135000-9
478 Dichlormetanas 24141300-7
479 Dietileteris 24146320-8
480 Dietileteris 24146320-8
481 Difenilkarbazidas 24146320-8
482 Dikalio vandenilio fosfatas 24133220-3
483 Dimetilglioksimas 24147000-6
484 Dinatrio vandenilio fosfatas, dihidratas 24133220-3
485 Druskos rūgštis 24131470-6
486 Druskos rūgštis 24131470-6
487 Dujinės chromatografijos etaloninių medžiagų (C1-C5 alkoholių) rinkinys 24147000-6
488 Dujos Azotas techninis 4.6 24111160-4
489 Dujos Helio dujos 4,6 24111131-2
490 Dujos Sintetinis oras 24111320-4
491 Dujos Vandenilis 5.0 24111150-1
492 Dujos, kalibravimo 24110000-8
493 Dujos, kalibravimo 24110000-8
494 Dujos, kalibravimo 24110000-8
495 DujosAcetilenas 24110000-8
496 DujosArgonas techninis 50 l 24111120-2
497 EDTA Dinatrio magnio (C10H12N2O8Na2Mg) 24147000-6
498 Elektrodo (R502 tipo) išorinis užpildymo tirpalas 1mol/l KNO3 24135000-9
499 Elektrodo (R502 tipo) vidinis užpildymo tirpalas 1mol/l KNO3 24135000-9
500 Elektrodo užpildymo tirpalas - elektrolito tirpalas KCl-AgCl 24135000-9
501 Elektros laidžio stand.tirpalas 1,413 µs/cm 24135000-9
502 Elektros laidžio stand.tirpalas 12180 µs/cm 24135000-9
503 Elektros laidžio stand.tirpalas 1413 µs/cm 24135000-9
504 Elektros laidžio stand.tirpalas 84 µs/cm 24135000-9
505 EPA 610-N Polynuclear Aromatic Hydrocarbon Kit 24147000-6
506 Erichromo juodasis T 24147000-6
507 Etaloninė medžiaga 4,4' – DDD ) 24147000-6
508 Etaloninė medžiaga 4,4' – DDT ) 24147000-8 24147000-6
509 Etaloninė medžiada Stirenas, Okenalas 24141225-7
510 Etaloninė medžiaga Heksachlorbutadienas 24147000-6
511 Etaloninė medžiaga 1,2-Dichloretanas 24141300-7
512 Etaloninė medžiaga 1.2-Dichloretanas 24141300-7
513 Etaloninė medžiaga 4,4-DDE 24141300-7
514 Etaloninė medžiaga 2-chloroetanolis 24147000-6
515 Etaloninė medžiaga 4,4-DDT 24147000-6
516 Etaloninė medžiaga Acetaldehidas 24146100-0
517 Etaloninė medžiaga Acetonas 24146000-9
518 Etaloninė medžiaga Acto rūgštis 24143210-3
519 Etaloninė medžiaga Aldrinas 24147000-6
520 Etaloninė medžiaga Atrazinas 24147000-6
521 Etaloninė medžiaga Azinofos - metilas 24147000-6
522 Etaloninė medžiaga Benz(a)pirenas 24147000-6
523 Etaloninė medžiaga Benzenas 24141221-9
524 Etaloninė medžiaga Bromdichlormetanas 24141300-7
525 Etaloninė medžiaga Bromoformas 24141300-7
526 Etaloninė medžiaga Butilacetatas 24141300-7
527 Etaloninė medžiaga Chloroformas 24141300-7
528 Etaloninė medžiaga Cianazinas 24147000-6
529 Etaloninė medžiaga Cipermetinas 24147000-6
530 Etaloninė medžiaga Dichloretanas 24141300-7 24141300-7
531 Etaloninė medžiaga Dichlormetanas 24141300-7
532 Etaloninė medžiaga Dimetachloras 24141300-7
533 Etaloninė medžiaga Endrin 24141300-7
534 Etaloninė medžiaga Epichlorhidrinas 24141300-7
535 Etaloninė medžiaga Etanolis 24142510-9
536 Etaloninė medžiaga Etilacetatas 24147000-6
537 Etaloninė medžiaga Etileno oksidas 24147000-6
538 Etaloninė medžiaga Flumetralin 24147000-6
539 Etaloninė medžiaga Flutriafolas 24147000-6
540 Etaloninė medžiaga Folpetas 24147000-6
541 Etaloninė medžiaga Heksachlorbenzenas 24141300-7
542 Etaloninė medžiaga Heksanas 24141100-5
543 Etaloninė medžiaga Heptachlor epoxide isomer A 24147000-6
544 Etaloninė medžiaga Heptadecane (vidinis standartas)GC 24141110-8
545 Etaloninė medžiaga Kaptanas 24147000-6
546 Etaloninė medžiaga Lindanas 24147000-6
547 Etaloninė medžiaga Malationas 24147000-6
548 Etaloninė medžiaga Metanolis 24142210-6
549 Etaloninė medžiaga Mirex 24147000-6
550 Etaloninė medžiaga m-Ksilenas 24141224-0
551 Etaloninė medžiaga monitoringinės cigaretės (analogiška Borgvald kompanijos produktui) 24147000-6
552 Etaloninė medžiaga Nikotinas 24147000-6
553 Etaloninė medžiaga Oksadilisilas 24147000-6
554 Etaloninė medžiaga o-Ksilenas 24141223-3
555 Etaloninė medžiaga Paration-metilas(chromatografijai) 24147000-6
556 Etaloninė medžiaga Pentachlorbenzenas (chromatografijai) 24141300-7
557 Etaloninė medžiaga Pesticide Standart Mix B 24147000-6
558 Etaloninė medžiaga Pirimifosas 24147000-6
559 Etaloninė medžiaga Pirimikarbas 24147000-6
560 Etaloninė medžiaga p-Ksilenas 24141220-2
561 Etaloninė medžiaga Simazinas 24147000-6
562 Etaloninė medžiaga Toluenas 24141222-6
563 Etaloninė medžiaga Triadimenolas 24147000-6
564 Etaloninė medžiaga VOA Extract Sereening Mix 1 24147000-6
565 Etaloninė medžiaga α - endosulfanas 24147000-6
566 Etaloninė medžiaga α - Heksachlorcikloheksanas (α – HCH) 24141300-7 24147000-6
567 Etaloninė medžiaga β-endosulfanas 24147000-6 24147000-6
568 Etaloninė medžiaga β-Heksachlorcikloheksanas (β – HCH) 24141300-7
569 Etaloninė medžiaga δ-Heksachlorcikloheksanas (δ – HCH) 24141300-7
570 Etaloninė medžiagaTrichloretilenas 24141300-7
571 Ethanethiol (etil merkaptanas) 24145000-2
572 Etilendiamin tetraacto rūgštis magnio dinatrio druska 24144100-6
573 Etilendiamino tetra acto rūgšties dinatrio druska 2H2O (trilonas B) 24144100-6
574 Etilendiamino tetraacto rūgštis (EDTA) 24144100-6
575 Etilenglikolis 24142310-7
576 Etilenglikolis 24142310-7
577 Fenolftaleinas 24142400-5
578 Fenolis 24142400-5
579 Florizilis 24135000-9
580 Fluoreksonas 24147000-6
581 Formaldehidas 40 % 24146100-0
582 Fosforo rūgštis 24131420-1
583 Geležies (II) amonio sulfatas 24133120-2
584 Geležies trichloridas,heksahidratas FeCl3´6H2O 24132122-9
585 Geležis metalinė 24131000-1
586 Gintaro rūgštis (C4H6O4) 24143200-0
587 Glicerinas 24142300-4
588 Glicinas 24144100-6
589 Gliukozė (D) 24147000-6
590 Gliutaraldehidas 24146000-9
591 Griso reagentas 24147000-6
592 Gyvsidabrio (II) sulfatas 24133120-2
593 Gyvsidabrio jodidas 24135000-9
594 Heksametilentetraminas (urotropinas) 24144100-6
595 Heksanas 24141100-5
596 Heksanas 24141100-5
597 Heksanas 24141100-5
598 Hidrazino sulfatas 24144000-5
599 Hidroksilamino hidrochloridas 24144100-6
600 Izooktanas 24147000-6
601 Jodas, kristalinis 24147000-6
602 Kadmio sulfatas 24133120-2
603 Kalceinas, geltonas 24147000-6
604 Kalcio chloridas, bevandenis, granulės 24132120-5
605 Kalcio karbonatas 24133300-8
606 Kalio bichromatas 24135000-9
607 Kalio chloridas 24132120-5
608 Kalio chromatas 24135000-9
609 Kalio divandenilio fosfatas 24133220-3
610 Kalio heksachlorplatinatas 24135000-9
611 Kalio heksaciano feriatas (III), trihidratas 24135000-9
612 Kalio hidrogenftalatas (C8KO4H5) 24147000-6
613 Kalio hidroksidas 24121000-8
614 Kalio jodatas, KJO3 24132100-9
615 Kalio jodidas 24135000-9
616 Kalio karbonatas 24133300-8
617 Kalio nitratas 24133400-9
618 Kalio nitritas 24135000-9
619 Kalio permanganatas 24134100-3
620 Kalio persulfatas (K2S2O8) 24133120-2
621 Kalio stibio tartratas, hemihidratas 24147000-6
622 Kalio sulfatas 24133120-2
623 Kalio tiocianatas 24131600-7
624 Kalio-aliuminio alūnas 24135000-9
625 Kalio-natrio tartratas 24147000-6
626 Kalkonkarboksilinė rūgštis bevandenė (indikatorius) 24143200-0
627 Kjeldalio tabletės 24131000-1
628 Kobalto (II) chloridas, heksahidratas 24132120-5
629 Kobalto sulfatas, heptahidratas 24133120-2
630 Krakmolas 24147000-6
631 Ksilenas 24141223-3
632 Lantano nitratas 24133400-9
633 Lantano oksidas 24121000-8
634 L-gliutamino rūgštis 24144100-6
635 Magnio acetatas×4H2O 24147000-6
636 Magnio modifikatorius AAS grafitinei krosniai 24135000-9
637 Magnio sulfatas, heptahidratas 24133120-2
638 Mangano chloridas tetrahidratas 24132120-5
639 Mangano sulfatas 5H2O 24133120-2
640 Mangano sulfatas H2O 24133120-2
641 Meta –fosforo rūgštis 24131420-1
642 Metanilo geltonas 24147000-6
643 Metanolis 24142210-6
644 Metanolis 24142210-6
645 Metileno mėlynas 24147000-6
646 Metilo raudonas 24147000-6
647 Metiloranžas 24147000-6
648 Mkrokristalinė celiuliozė 24147000-6
649 Molekuliniai sietai 0,3mm su drėgmės indikatoriumi 24137000-3 24147000-6
650 Multielementinis metalų tirpalas 24135000-9
651 N aliltiourea 24145000-2
652 N-(1-naftil)-1,2-diaminoetandihidrochloridas (C10H7NHCH2CH2NH2•2HCl) 24144100-6
653 N,N dimetil-p-fenilendiamias 24144100-6
654 N,N-dietil-1,4-fenilendiamino sulfatas 24144100-6
655 N,N-dimetil-n-fenilendiamino dihidrocloridas 24144100-6
656 N,N-natrio dietilditiokarbomatas 24131600-7
657 Natrio acetatas, trihidratas 24147000-6
658 Natrio borohidridas 24131130-1
659 Natrio chloridas 24132210-3
660 Natrio citratas, dihidratas 24135000-9
661 Natrio dichloroizocianourato dihidratas (C3N3O3Cl2Na×2H2O) 24147000-6
662 Natrio dihidrofosfatas 24133220-3
663 Natrio dodecil sulfatas 24133120-2
664 Natrio fluoridas 24135000-9
665 Natrio hidro karbonatas 24133320-4
666 Natrio hidrofosfatas 24133320-4
667 Natrio hidroksidas 24131520-2
668 Natrio hipochloritas (aktyvaus chloro 5 %) 24132220-6
669 Natrio karbonatas, bevandenis 24133310-1
670 Natrio laurilsulfatas 24147000-6
671 Natrio molibdatas Na2MoO4 ×2H2O 24135000-9
672 Natrio nitratas 24133400-9
673 Natrio nitritas 24135000-9
674 Natrio nitroprusidas [Fe(CN)5NO]Na2×2H2O 24135000-9
675 Natrio oksalatas 24135000-9
676 Natrio pirosulfitas 24133100-6
677 Natrio salicilatas (C7H5NaO3) 24147000-6
678 Natrio sufatas, bevandenis 24133124-0
679 Natrio sulfatas bevandenis 24133124-0
680 Natrio sulfidas nonahidratas 24133110-9
681 Natrio sulfitas (bevandenis) 24133100-6
682 Natrio tetraboratas, Na2B4O7∙10H2O 24135700-6
683 Natrio tiosulfatas 5H2O 24133121-9
684 Neslerio reagentas 24135000-9
685 Nikelio sulfatas heksahidratas 24133120-2
686 Nitrobenzenas 24141221-9
687 Paladžio modifikatorius AAS grafitinei krosniai 24135000-9
688 Paliudyta pamatinė medžiaga - grūdų produktų pagrindu - analpgiška BCR-382 24147000-6
689 Paliudyta pamatinė medžiaga analogiška BCR 189 24147000-6
690 Paliudyta pamatinė medžiaga - mėsos produkto pagrindu - analogiška BCR-384 24147000-6
691 Perchloro rūgštis 24131410-8
692 Petroleteris (virimo t-ra 24146320-8
693 pH buferis 10,00 ± 0,02 24135000-9
694 pH buferis 4,00 ± 0,02 24135000-9
695 pH buferis 6,00 ± 0,02 24135000-9
696 pH buferis 7,00 ± 0,02 24135000-9
697 pH buferis 9,00 ± 0,02 24135000-9
698 Piridinas 24147000-6 24135000-9
699 Pirokatecholis violetinis 24135000-9
700 Propanolis-2 24142200-3
701 Reagentų rinkinys ECD detektoriaus patikrinimui 24147000-6
702 Reagentų rinkinys ECD detektoriaus patikrinimui 24147000-6
703 Reagentų rinkinys FID detektoriaus patikrinimui 24147000-6
704 Reagentų rinkinys FID detektoriaus patikrinimui 24147000-6
705 Reagentų rinkinys NPD detektoriaus patikrinimui 24147000-6
706 Reagentų rinkinys NPD detektoriaus patikrinimui 24147000-6
707 Rezorcinolis 24142400-5
708 Sacharozė 24147000-6
709 Salicilo rūgštis 24143200-0
710 Sidabro dietilditijokarbamatas 24135000-9
711 Sidabro nitratas 24133400-9
712 Sidabro sulfatas 24133120-2
713 Sieros rūgštis 24131411-5
714 Sieros rūgštis 24131411-5
715 Silikagelis raudonas (indikatorius) 24135000-9
716 Sorbo rūgštis 24143200-0
717 Stand. tirpalas (drumstumas) 4000 DV 24135000-9
718 Stand. tirpalas (spalva) 500 mg Pt /l 24135000-9
719 Standartinis acto rūgšties tirpalas 0,1mol/l 24143210-3
720 Standartinis Aliuminio tirpalas 24641250-6
721 Standartinis Amonio tirpalas 24135000-9
722 Standartinis Arseno tirpalas 24135000-9
723 Standartinis Azoto rūgšties tirpalas, 0,1mol/l 24151100-8
724 Standartinis Bendro kietumo tirpalas 24135000-9
725 Standartinis Boro tirpalas 24135000-9
726 Standartinis Chlorido tirpalas 24132120-5
727 Standartinis Chromo tirpalas 24135000-9
728 Standartinis Chromo (VI) tirpalas 24135000-9
729 Standartinis Cianido tirpalas 24135210-4
730 Standartinis Cinko tirpalas 24135000-9
731 Standartinis Druskos rūgšties tirpalas 24131470-6
732 Standartinis Druskos rūgšties tirpalas 24131470-6
733 Standartinis Fenolio tirpalas 24142400-5
734 Standartinis Fluorido tirpalas 24135000-9
735 Standartinis Fluorido tirpalas 24135000-9
736 Standartinis Fosfato tirpalas 24133220-3
737 Standartinis Geležies tirpalas 24135000-9
738 Standartinis Geležies tirpalas 24135000-9
739 Standartinis Gyvsidabrio tirpalas 24135000-9
740 Standartinis jodo tirpalas 24135000-9
741 Standartinis Kadmio tirpalas 24135000-9
742 Standartinis Kalcio karbonato tirpalas 24135000-9
743 Standartinis Kalcio tirpalas 24135000-9
744 Standartinis Kalio bichromato tirpalas 24135000-9
745 Standartinis Kalio bichromato tirpalas 24135000-9
746 Standartinis Kalio bichromato tirpalas, fiksanalis 24135000-9
747 Standartinis Kalio bihromato tirpalas, fiksanalis 24135000-9
748 Standartinis Kalio chlorido tirpalas 24132120-5 24135000-9
749 Standartinis Kalio chlorido tirpalas 24135000-9
750 Standartinis Kalio permanganato tirpalas 24134100-3
751 Standartinis Kalio permanganato tirpalas 24134100-3
752 Standartinis kontrolinis tirpalas narvelio konstantai elektroniniam laidžiui (WTW firmos) 24132120-5
753 Standartinis Magnio tirpalas 24135000-9
754 Standartinis Mangano tirpalas 24135000-9
755 Standartinis natrio chlorido tirpalas 24132210-3
756 Standartinis Natrio chlorido tirpalas 24132210-3
757 Standartinis Natrio chlorido tirpalas 24132210-3
758 Standartinis natrio hidroksido tirpalas 24131522-6
759 Standartinis natrio hidroksido tirpalas 24131522-6
760 Standartinis natrio karbonato tirpalas 24133310-1
761 Standartinis natrio oksalato tirpalas 24147000-6
762 Standartinis natrio oksalato tirpalas 24147000-6
763 Standartinis natrio tiosulfato tirpalas 24133121-9
764 Standartinis Nikelio tirpalas 24135000-9
765 Standartinis Nitrato tirpalas 24133400-9
766 Standartinis Nitrito tirpalas 24135000-9
767 Standartinis Oksalo rūgšties tirpalas 24135000-9
768 Standartinis Seleno tirpalas 24135000-9
769 Standartinis Sidabro nitrato tirpalas 24133400-9
770 Standartinis Sidabro nitrato tirpalas 24133400-9
771 Standartinis Sidabro nitrato tirpalas, fiksanal. 24133400-9
772 Standartinis sidabro nitrato tirpalas, fiksanal.0,1 mol/l 24133400-9
773 Standartinis sieros rūgšties tirpalas 24131411-5
774 Standartinis sieros rūgšties tirpalas 24131411-5
775 Standartinis sieros rūgšties tirpalas 24131411-5
776 Standartinis Sieros rūgšties tirpalas, fiksanalas 24131411-5
777 Standartinis Stibio tirpalas 24135000-9
778 Standartinis Sulfato tirpalas 24133120-2
779 Standartinis tirpalas poliaromatiniams angliavandeniliams nustatyti 24147000-6
780 Standartinis tirpalas TISAB fluoridų nustatymui 24147000-6
781 Standartinis Trilono B tirpalas 24135000-9
782 Standartinis Vario tirpalas 24135000-9
783 Standartinių formazino tirpalų rinkinys STABCAL Firmos HACH turbidimetrui 2100N 24147000-6
784 Sulfamo rūgštis 24147000-6
785 Sulfanilamidas (NH2C6H4SO2NH2) (arba 4-aminobenzensulfamido) 24144100-6
786 Sulfanilo rūgštis 24144400-9
787 Sulfarsazenas 24147000-6
788 Švino nitratas 24133400-9
789 Tetrahidrofuranas 24147000-6
790 Tetrahidrofuranas 24147000-6
791 Tetrahidrofuranas 24147000-6
792 Tiošlapalas 24145000-2
793 Tirpalas KCL –250-3 mol/l 24132120-5
794 Trans-Chlordane(γ-Chlordane) Ac100ug/µl 24147000-6
795 Tretinis butilo alkoholis (tret butanolis) 24142400-5
796 Trietanolaminas 24144100-6
797 Trilonas B 24144100-6
798 Trilonas B (Etilentetramino tetraacto rūgšties dinatrio druska) 24144100-6
799 Vandenilio peroksidas 24135300-2
800 Vandenilio peroksidas 24135300-2
801 Vario sulfatas, pentahidratas 24133126-4
802 Vyno rūgštis 24143200-0
803 WTW Elektrolitas ELY/G 205217 24135000-9
804 WTW Ploviklis RL-G 205217 24135000-9
805 WTW Technical Buffer pH 10,00 24135000-9
806 WTW Technical Buffer pH 4,00 24135000-9
807 WTW Technical Buffer pH 7,00 24135000-9
808 Antgaliai, 200 µl talpos , vienkartiniai plastikiniai 36731000-4
809 Antgaliai,1 ml talpos, vienkartiniai plastikiniai 36731000-4
810 Antgaliai,5 ml talpos, vienkartiniai plastikiniai 36731000-4
811 Apsauginiai akiniai 25240000-5
812 Buteliukai chromatografui 36731000-4
813 Buteliukai, užsukami stikliniai 36731000-4
814 Buteliukai, užsukami stikliniai 36731000-4
815 Buteliukas, tamsaus stiklo, neužsukamas, be šlifo 26131300-8
816 Buteliukas, užsukamas, stiklinis 36731000-4
817 Buteliukas, viršerdvės mėginių tyrimo 36731000-4
818 Butirometras 26152330-0
819 Cilindras, matavimo 26152330-0
820 Cilindras, matavimo 26152330-0
821 Cilindras, matavimo 26152330-0
822 Cilindras, matavimo 26152330-0
823 Cilindras, matavimo 26152330-0
824 Cilindras, matavimo, stiklinis 26152330-0
825 Cilindras, matavimo, stiklinis 26152330-0
826 Cilindras, matavimo, stiklinis, su stikliniu pagrindu 26152330-0
827 Cilindras, matavimo, stiklinis, su stikliniu pagrindu 26152330-0
828 Cilindras, matavimo, stiklinis, su stikliniu pagrindu 26152330-0
829 Cilindras, matavimo, stiklinis, su stikliniu pagrindu 26152330-0
830 Cilindras, matavimo, stiklinis, su stikliniu pagrindu 26152330-0
831 Cilindras, matavimo, stiklinis, su stikliniu pagrindu 26152330-0
832 Dragerio vamzdeliai 26152330-0
833 Dragerio vamzdeliai 26152330-0
834 Dragerio vamzdeliaieliai 26152330-0
835 Dragerio vamzdeliaieliai 26152330-0
836 Dragerio vamzdeliaieliai 26152330-0
837 Dragerio vamzdeliaieliai 26152330-0
838 Dragerio vamzdeliaieliai 26152330-0
839 Dragerio vamzdeliaieliai 26152330-0
840 Dragerio vamzdeliaieliai 26152330-0
841 Dragerio vamzdeliaieliai 26152330-0
842 Dragerio vamzdeliaieliai 26152330-0
843 Ferulės 36731000-4
844 Ferulės 36731000-4
845 Ferulės 36731000-4
846 Filtrai 36712000-5
847 Filtrai 36712000-5
848 Filtrai 36712000-5
849 Filtrai 36712000-5
850 Filtras (dedamas ant švirkšto) 36712000-5
851 Filtras membraninis 36712000-5
852 Filtras membraninis 36712000-5
853 Filtras membraninis 36712000-5
854 Filtras membraninis 36712000-5
855 Filtras membraninis 36712000-5
856 Filtras membraninis 36712000-5
857 Filtras membraninis 36712000-5
858 Filtras membraninis, celiuliozė nitrate 36712000-5
859 Filtras membraninis, celiuliozė nitrate 36712000-5
860 Filtras membraninis, celiuliozė nitrate 36712000-5
861 Filtro popierius 36712000-5
862 Filtro popierius 36712000-5
863 Filtro popierius 36712000-5
864 Filtro popierius 36712000-5
865 Filtro popierius 36712000-5
866 Filtro popierius 36712000-5
867 Filtro popierius 36712000-5
868 Filtro popierius 36712000-5
869 Filtro popierius 36712000-5
870 Filtro popierius 36712000-5
871 Filtro popierius 36712000-5
872 Filtro popierius 36712000-5
873 Filtro popierius 36712000-5
874 Filtro popierius 36712000-5
875 Folija, aliuminio 27521500-8
876 Garinimo lėkštelė 26241300-2
877 Gaudyklės, stiklinės, oro mėginių paėmimui 26152330-0
878 Guminė kriaušė 25100000-2
879 Guminė kriaušė 25100000-2
880 Guminė kriaušė Nr. 3 25100000-2
881 Guminė kriaušė Nr. 6 25100000-2
882 Guminė žarnelė 25100000-2
883 Guminė žarnelė 25100000-2
884 Indas, matavimo su rankena (plastmasinis) 25240000-5
885 Indikatorinis popierius, universalus 36731000-4
886 Kaištukai silikoniniams vamzdeliams (žarnoms) 26152330-0
887 Kamštelis su tarpine viršerdvės mėginių tyrimo buteliukams 36731000-4
888 Kamštelis, užsukami 36731000-4
889 Kamštis Kjeldalio kolbai, stiklinis 26152330-0
890 Kolba , matavimo(stiklinė), talpa 100 ml su plastikiniu kamščiu 26152330-0
891 Kolba apvaliadugnė su šlifu 26152330-0
892 Kolba apvaliadugnė su šlifu 26152330-0
893 Kolba, apvaliadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
894 Kolba, apvaliadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
895 Kolba, apvaliadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
896 Kolba, erlenmejerio 26152330-0
897 Kolba, erlenmejerio 26152330-0
898 Kolba, erlenmejerio, su šlifu ir stikliniu kamščiu 26152330-0
899 Kolba, matavimo (stiklinė), talpa 1000 ml su plastikiniu kamščiu 26152330-0
900 Kolba, matavimo (stiklinė), talpa 1000 ml su plastikiniu kamščiu 26152330-0
901 Kolba, matavimo (stiklinė), talpa 250 ml su plastikiniu kamščiu 26152330-0
902 Kolba, matavimo (stiklinė), talpa 50 ml su plastikiniu kamščiu 26152330-0
903 Kolba, matavimo (stiklinė), talpa 50 ml su plastikiniu kamščiu 26152330-0
904 Kolba, matavimo (stiklinė), talpa 500 ml su plastikiniu kamščiu 26152330-0
905 Kolba, matavimo (stiklinė), talpa 500 ml su plastikiniu kamščiu 26152330-0
906 Kolba, matavimo, (stiklinė), talpa 1 ml su plastikiniu kamščiu 26152330-0
907 Kolba, matavimo, (stiklinė), talpa 20 ml su stikliniu kamščiu 26152330-0
908 Kolba, matavimo, (stiklinė), talpa 25 ml su stikliniu kamščiu 26152330-0
909 Kolba, matavimo, stiklinė su šlifiniu kamšteliu 26152330-0
910 Kolba, plokščiadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
911 Kolba, plokščiadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
912 Kolba, plokščiadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
913 Kolba, plokščiadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
914 Kolba, plokščiadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
915 Kolba, plokščiadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
916 Kolba, plokščiadugnė, su šlifiniu kamščiu, termoatspari 26152330-0
917 Kolba,dvigurklė apvaliadugnė, 1 l su šlifu 26152330-0
918 Kolbos konusinės 26152330-0
919 Kolbos konusinės 26152330-0
920 Koštuvai 36731000-4
921 Laboratorinė plėvelė Parafilm „M“ 25213000-7
922 Laikrodis, smėlio 29852340-1
923 Laikrodis, smėlio 29852340-1
924 Lainerio tvirtinimo tarpinės (O-ring) 36731000-4
925 Lainerio tvirtinimo tarpinės (O-ring) 36731000-4
926 Lašų gaudiklis (Kjeldalio tipo) 26152330-0
927 Lašų gaudytuvas su šlifu 26152330-0
928 Lazdelė magnetukams išimti 27110000-9
929 Lėkštelė, porcelianinė 26241300-2
930 Lėkštelė, porcelianinė, su snapeliu 26241300-2
931 Maišiklis, magnetinis 27110000-9
932 Maišiklis, magnetinis 27110000-9
933 Maišiklis, magnetinis 27110000-9
934 Maišiklis, magnetinis 27110000-9
935 Maišiklis, magnetinis 27110000-9
936 Maišiklis, magnetinis 27110000-9
937 Matavimo kolba (stiklinė), talpa 10 ml su stikliniu kamščiu 26152330-0
938 Matavimo kolba (stiklinė), talpa 200 ml su plastikiniu kamščiu 26152330-0
939 Matavimo kolba (stiklinė), talpa 200 ml su plastikiniu kamščiu 26152330-0
940 Mėgintuvėlis 26152339-3
941 Mėgintuvėlis negraduotas , stiklinis, su šlifiniu kamščiu 26152339-3
942 Mėgintuvėlis termoatsparus 26152339-3
943 Mėgintuvėlis termoatsparus 26152339-3
944 Mėgintuvėlis, graduotas ,stiklinis su šlifiniu kamščiu 26152339-3
945 Mėgintuvėlis, graduotas ,stiklinis su šlifiniu kamščiu 26152339-3
946 Mėgintuvėlis, graduotas ,stiklinis su šlifiniu kamščiu 26152339-3
947 Mėgintuvėlis, graduotas ,stiklinis su šlifiniu kamščiu 26152339-3
948 Mėgintuvėlis, graduotas ,stiklinis su šlifiniu kamščiu 26152339-3
949 Mėgintuvėlis,centrifuginis, plastikinis 25240000-5
950 Mėgintuvėlis,centrifuginis, plastikinis 25240000-5
951 Mėgintuvėlis,centrifuginis, plastikinis 25240000-5
952 Mikrošpatelis (mentelės birioms medžiagoms) 27110000-9
953 Piltuvėlis 26152330-0
954 Piltuvėlis stiklinis 26152330-0
955 Pipetė plastmasinė (Pastero) 25240000-5
956 Pipetė stiklinė graduota 1 ml 26152330-0
957 Pipetė stiklinė graduota 1 ml 26152330-0
958 Pipetė stiklinė graduota 10 ml 26152330-0
959 Pipetė stiklinė graduota 10 ml 26152330-0
960 Pipetė stiklinė graduota 2 ml 26152330-0
961 Pipetė stiklinė graduota 2 ml 26152330-0
962 Pipetė stiklinė graduota 5 ml 26152330-0
963 Pipetė stiklinė graduota 5 ml 26152330-0
964 Pipetė stiklinė vienažymė (Moro) 1 ml 26152330-0
965 Pipetė stiklinė vienažymė (Moro) 5 ml 26152330-0
966 Pipetė stiklinė vienažymė (Moro) 10 ml 26152330-0
967 Pipetė stiklinė vienažymė (Moro) 10 ml 26152330-0
968 Pipetė stiklinė vienažymė (Moro) 100 ml 26152330-0
969 Pipetė stiklinė vienažymė (Moro) 20 ml 26152330-0
970 Pipetė stiklinė vienažymė (Moro) 25 ml 26152330-0
971 Pipetė stiklinė vienažymė (Moro) 40 ml 26152330-0
972 Pipetė stiklinė vienažymė (Moro) 50 ml 26152330-0
973 Pipetė, Pastero 26152330-0
974 Silikoninė žarnelė 25212210-5
975 Silikoninė žarnelė 25212210-5
976 Silikoniniai vamzdeliai 25212210-5
977 Sorbciniai vamzdeliai 26152330-0
978 Sorbciniai vamzdeliai 26152330-0
979 Sorbciniai vamzdeliai ST-112 (СТ-112) (Nr. 1) 26152330-0
980 Sorbciniai vamzdeliai ST-212 (СТ-212) 26152330-0
981 Stiklinė 26132000-2
982 Stiklinė 26132000-2
983 Stiklinė 26132000-2
984 Stiklinė 26132000-2
985 Stiklinė 26132000-2
986 Stiklinė 26132000-2
987 Stiklinė 26132000-2
988 Stiklinė 26132000-2
989 Stiklinė 26132000-2
990 Stiklinė 26132000-2
991 Stiklinė 26132000-2
992 Stiklinė 26132000-2
993 Stiklinė 26132000-2
994 Stiklinė 26132000-2
995 Stiklinė 26132000-2
996 Stiklinė lazdelė užapvalintais galais 26132000-2
997 Stiklinė lazdelė užapvalintais galais 26132000-2
998 Stovas mėgintuvėliams 25240000-5
999 Stovas mėgintuvėliams 25240000-5
1000 Stovas mėgintuvėliams 25240000-5
1001 Sugėrėjas su poringomis plokštelėmis 26152330-0
1002 Sujungėjas 26152330-0
1003 Svėrimo indeliai (vienkartiniai) 36731000-4
1004 Svėrimo indeliai (vienkartiniai) 36731000-4
1005 Svėrimo indeliai (vienkartiniai) 36731000-4
1006 Svėrimo indeliai (vienkartiniai) 36731000-4
1007 Šepečiai 36673200-1
1008 Šepečiai 36673200-1
1009 Šepečiai 36673200-1
1010 Šlifinis kamštis 26152330-0
1011 Špateliai (mentelės birioms medžiagoms) 27110000-9
1012 Švirkštas, veterinarinis 26152330-0
1013 Švirkštas, vienkartinis 36731000-4
1014 Tarpinės 36731000-4
1015 Tarpinės tefloninės 36731000-4
1016 Tarpinės, injektoriaus 25240000-5
1017 Termometras, spiritinis 26152330-0
1018 Tiglis porcelianinis, ugniai atsparus 26200000-0
1019 Tiglis porcelianinis, ugniai atsparus 26200000-0
1020 Valiklis pypkėms 36731000-4
1021 Vamzdeliai, silikoniniai 36712200-7
1022 Vamzdeliai,palmių anglies, absorbciniai - anasorb CSC Coconut Charcoal (SKC firmos, katalogas Nr. 226-01) 26152330-0
1023 Žarnelė silikoninė 25212210-5
1024 Žiedelis 27520000-6
1025 ELISA rinkiniai Tuliaremijos nustatymui 33141625-7
1026 Diagnostiniai rinkiniai bioanalizatoriui "miniVIDAS" 33141625-7
1027 Legioneliozės diagnostikos rinkiniai 33141625-7
1028 Kokliušo diagnostikos rinkiniai 33141625-7
1029 Helmintozių (trichineliozės, toksokarozės, cisticerkozės) diagnostiniai rinkiniai. 33141625-7
1030 Echinokokozės diagnostiniai rinkiniai 33141625-7
1031 Alergijos diagnostikos rinkiniai 33141625-7
1032 Žarnyno parazitų išmatose nustatymo rinkiniai 33141625-7
1033 Objetiniai stikliukai 26152330-0
1034 Objetiniai stikliukai 26152330-0
1035 Dengiamieji stikliukai 26152330-0
1036 Dengiamieji stikliukai 26152330-0
1037 Dengiamieji stikliukai 26152330-0
1038 Mikromėgintuvėliai 25200000-3
1039 Mėgintuvėliai 25200000-3
1040 Mėgintuvėliai 25200000-3
1041 Vata medicininė, chirurginė 33141110-4
1042 Mėgintuvėliai 26152339-3
1043 Parafilmas 25200000-3
1044 Piltuvėliai 26100000-9
1045 Antgaliai automatinei pipetei 1 ml 25200000-3
1046 Antgaliai elektroninei pipetei 25200000-3
1047 Antgaliai elektroninei pipetei 25200000-3
1048 Antgaliai elektroninei pipetei 25200000-3
1049 Antgaliai elektroninei pipetei 25200000-3
1050 Antgaliai elektroninei pipetei 25200000-3
1051 Pipete plastikinė 3 ml graduota 25200000-3
1052 Pincetas 25200000-3
1053 Vienkartiniai maišeliai 25200000-3
1054 Šepetėlis mėgintuvėlių plovimui 25200000-3
1055 Šaukštelis-špatelis 25200000-3
1056 Stovas mėgintuvėliams 25200000-3
1057 Stovas mėgintuvėliams 25200000-3
1058 Lėkštelės svėrimui 25200000-3
1059 Laboratorinis laikmatis 25200000-3
1060 Konusinė kolba 25200000-3
1061 Konusinė kolba 25200000-3
1062 Butelis plovimui 25200000-3
1063 Butelis dozatorius (Dispenseris) 25200000-3
1064 Vienkanalis kintamo tūrio dozatorius 25200000-3
1065 Daugiakanalė automatinė pipetė- dozatorius 25200000-3
1066 Plastikinis butelis dezinfekcinių medžiagų purškimui 25200000-3
1067 Petri lėkštelės, 90x14 mm 25200000-3
1068 Losjonas rankoms 24250000-1
1069 Želė rankoms dezinfekuoti 24250000-1
1070 Želė rankoms dezinfekuoti 24250000-1
1071 Dėžutės objektinių stikliukų transportavimui 25200000-3
1072 Popieriniai filtrai 25200000-3
1073 Diagnostiniai rinkiniai analizatoriui IMMULITE PLUS 33141625-7
1074 Diagnostiniai rinkiniai analizatoriui REFLOTRON PLUS 33141625-7
1075 Diagnostiniai rinkiniai analizatoriui COAGULATOR 2 33141625-7
1076 Diagnostiniai rinkiniai analizatoriui URISCAN optima II 33141625-7
1077 Testas slaptam kraujui fekalijose nustatyti Hema-screen 33141625-7
1078 Dengiamieji stikliukai 26152330-0
1079 Kiuvetės BE 25200000-3
1080 Rutuliukai BE 25200000-3
1081 Sample Cups 25200000-3
1082 Mikromėgintuvėliai 25200000-3
1083 Pipetė plastikinė 3 ml graduota 25200000-3


IV. PIRKIMO BŪDAS

1. PIRKIMO BŪDO PAVADINIMAS
Supaprastintas atviras konkursas 

3. ANKSTESNIO PIRKIMO, DĖL KURIO PASIRINKTAS SKELBIAMŲ DERYBŲ, NESKELBIAMŲ DERYBŲ BŪDAS, SUPAPRASTINTŲ PIRKIMŲ ATVEJAIS, KAI APIE PIRKIMĄ NEBUVO SKELBTA, PIRKIMO NUMERIS (-IAI)
 

4. AR PIRKIMAS ATLIEKAMAS TAIKANT DINAMINĘ PIRKIMŲ SISTEMĄ?   TAIP          NE     
V. VOKŲ SU PASIŪLYMAIS ATPLĖŠIMO PROCEDŪRA
1. Vokų su pasiūlymais (orientaciniais pasiūlymais) atplėšimo data ir laikas arba pasiūlymų pateikimo termino pabaigos data ir laikas (supaprastintų pirkimų atveju, jeigu nevykdoma vokų su pasiūlymais atlpėšimo procedūra)
2008-02-04    10:00 
VI. PIRKIMO PRADŽIA
1. IŠANKSTINIAI SKELBIMAI APIE PIRKIMĄ
     1.1. skelbimo išsiuntimo iš Viešųjų pirkimų tarnybos data
 
     1.2. skelbimo paskelbimo Centrinėje viešųjų pirkimų informacinėje sistemoje data
(pildyti, jei skelbta nurodytoje sistemoje)
 
     1.3. skelbimo paskelbimo Europos Bendrijos oficialiame leidinyje data
(pildyti, jeigu skelbtas tarptautinis skelbimas)
 
2. SKELBIMAI APIE PIRKIMĄ
     2.1. skelbimo išsiuntimo iš Viešųjų pirkimų tarnybos data
2008-01-07 
     2.2. skelbimo paskelbimo Centrinėje viešųjų pirkimų informacinėje sistemoje data
(pildyti, jei skelbta nurodytoje sistemoje)
 
     2.3. skelbimo paskelbimo Europos Bendrijos oficialiame leidinyje data
(pildyti, jeigu skelbtas tarptautinis skelbimas)
2008-01-09 
3. SUPAPRASTINTI SKELBIMAI APIE PIRKIMĄ DINAMINĖJE PIRKIMŲ SISTEMOJE
     3.1. skelbimo išsiuntimo iš Viešųjų pirkimų tarnybos data
 
     3.2. skelbimo paskelbimo Centrinėje viešųjų pirkimų informacinėje sistemoje data
(pildyti, jei skelbta nurodytoje sistemoje)
 
     3.3. skelbimo paskelbimo Europos Bendrijos oficialiame leidinyje data
(pildyti, jeigu skelbtas tarptautinis skelbimas)
 

4. TAIS ATVEJAIS, KAI BUVO SKELBTAS PRANEŠIMAS DĖL SAVANORIŠKO EX ANTE SKAIDRUMO IR/ARBA
SUPAPRASTINTŲ PIRKIMŲ ATVEJU, JEIGU BUVO SKELBTAS INFORMACINIS PRANEŠIMAS APIE SPRENDIMĄ PIRKTI PREKES,
PASLAUGAS AR DARBUS NEPASKELBUS APIE PIRKIMĄ
     4.1. informacinio pranešimo/ pranešimo dėl savanoriško ex ante skaidrumo paskelbimo Centrinėje viešųjų pirkimų informacinėje sistemoje data (pildyti, jeigu skelbta nurodytoje sistemoje)
 
     4.2. pranešimo dėl savanoriško ex ante skaidrumo paskelbimo Europos Bendrijų oficialiame leidinyje data
 
5. KVIETIMO PATEIKTI PASIŪLYMUS DATA (pildyti, tik jeigu buvo atliktas pirkimas neskelbiamų derybų būdu ar supaprastintų pirkimų atvejais, kai apie pirkimą neskelbiama)
 
VII. DALYVIAI (KANDIDATAI)
Pavadinimas Kodas Adresas Šalis
Uždaroji akcinė bendrovė "PRO ARIS" 225955760  M. K. Čiurlionio g. 4-4, Vilnius  Lietuva 
L. R. Tamulio firma "Meditalika" 134565744  Radvilų Dvaro g. 2, Kauno m. sav. Kauno m.  Lietuva 
A. Tamošiūno įmonė 147316390  Marijonų g. 45, Panevėžio m., LT-35125 Panevėžio m. sav.  Lietuva 
UAB "Grida LAB" 178313232  Molėtų g. 16, Didžioji Riešė, Vilniaus r,  Lietuva 
Uždaroji akcinė bendrovė "ARDEOLA" 221731170  T.Vrublevskio g. 6-17,LT-01100 Vilnius  Lietuva 
UAB "ILSANTA" 110498671  Gedimino pr. 45-5, LT-01109, Vilnius  Lietuva 
Uždaroji akcinė bendrovė "DERAIMAS" 163225424  Kalotės k., Klaipėdos r. sav.  Lietuva 
UAB "Diagnostinės sistemos" 122263421  P. Smuglevičiaus g. 1, LT-08311 Vilnius  Lietuva 
UAB "DIAMEDICA" 111768155  Statybininkų g. 8-13, Vilniaus m. sav. Vilniaus m.  Lietuva 
Uždaroji akcinė bendrovė "SUVA" 121952584  Savanorių pr. 180-54, Vilniaus m., 01354 Vilniaus m. sav.  Lietuva 
Uždaroji akcinė bendrovė "Skirgesa" 234449420  Ekskavatorininkų 1b, LT-52461 Kaunas  Lietuva 
UAB "Optinė riba" 300046335  Ekskavatorininkų g. 1B, Kauno m., 52461 Kauno m. sav.  Lietuva 
UAB "Baltijos Inoma" 126342599  A. Goštauto g. 4-53, Vilniaus m., 2000 Vilniaus m. sav.  Lietuva 
UAB "Roche Lietuva" 300089404  J. Jasinskio g. 16A, Vilniaus m., Vilniaus m. sav.  Lietuva 
Uždaroji akcinė bendrovė "BIOMETRIJA" 123221635  Rygos g. 15, LT-05245 Vilnius  Lietuva 
UAB "Oriola–Vilnius" 111472747  Laisvės pr. 75, LT-06144 Vilnius  Lietuva 
A. Zapalskio IĮ "Azas" 147838431  Beržų g. 10, Panevėžio m., LT-36233 Panevėžio m. sav.  Lietuva 
Uždaroji akcinė bendrovė "GENERIX" 122752661  Šeimyniškių g. 14-1, Vilniaus m., 2005 Vilniaus m. sav.  Lietuva 
Uždaroji akcinė bendrovė "ELME MESSER LIT" 111609726  Ateities g. 10, Vilniaus m., Vilniaus m. sav.  Lietuva 
UAB 'Linea libera' 122145775  Akademijos g. 2, 08412 Vilnius  Lietuva 
UAB "Siemens Medical Solutions Diagnostics" 111645576  S. Žukausko g. 23, Vilniaus m., Vilniaus m. sav.  Lietuva 
UAB 'Genomas' 145012392  Vilniaus r. sav. Zujūnų k. Gelažių g. 24  Lietuva 
Uždaroji akcinė bendrovė "ANMEDA" 210845870  Baltupio g. 91-1, Vilniaus m., Vilniaus m. sav.  Lietuva 
Uždaroji akcinė bendrovė "Bioeksma" 300096612  Mokslininkų g. 11, Vilniaus m., Vilniaus m. sav.  Lietuva 
UAB "Labochema LT" 300670772  Vilkpėdės g. 22, Vilnius  Lietuva 
UAB 'Interlux' 110608112  Aviečių g. 16, LT-08418, Vilnius  Lietuva 
UAB 'Opus Medicum' 300516589  Laisvės pr. 87B-7, LT-06121 Vilnius  Lietuva 
Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras 122889222  Mokslininkų g. 11, LT-08412 Vilnius  Lietuva 
UAB "BIOTECHA" 300630105  Antakalnio g. 36, Vilnius  Lietuva 


VIII. PASIŪLYMŲ VERTINIMAS
1. PASIŪLYMŲ VERTINIMO KRITERIJAI
Ekonomiškai naudingiausio pasiūlymo
Mažiausios kainos
Skirtingoms pirkimo objekto dalims taikomi skirtingi vertinimo kriterijai (detalizuoti žemiau esančioje lentelėje)
Vertinimo kriterijus Pirkimo objekto dalies (-ių) numeris (-iai)
Ekonomiškai naudingiausio pasiūlymo  
Mažiausios kainos  

Pirkimo objekto dalies (-ių) numeris (-iai) Kandidato pavadinimas
     

3. ATMESTI PASIŪLYMAI (GALUTINIAI PASIŪLYMAI)
Pirkimo objekto dalies (-ių) numeris (-iai) Dalyvio pavadinimas Pasiūlymo atmetimo teisiniai pagrindai Atmetimo priežastys Pasiūlymo kaina (Lt) Pasiūlymo kainos išraiška
 5   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Siūlomas skystame pavidale  141,60  
 13   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras  39 str. 2 d. 2 p.  Siūlomas rinkinys skirtas gripo diagnostikai  378,00  
 22   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Fasuotė neatitinka specifikacijos, siūlomas reagentas išfasuotas flakonais po 15 ml, o ne lašintuvais (droperiais)  235,20  
 55   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Nenurodyta reagentų rinkinio sudėtis, kokie antibiotikai įeina į rinkinio sudėtį.  6.930,00  
 130   A. Tamošiūno įmonė  39 str. 2 d. 2 p.  Fasuotė neatitinka specifikacijos  19,82  
 134   UAB "Oriola–Vilnius"  39 str. 2 d. 2 p.  Fasuotė neatitinka specifikacijos  84.199,50  
 214   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolei nurodytas kitos kultūros  15.192,50  
 214   Uždaroji akcinė bendrovė "GENERIX"  39 str. 2 d. 2 p.  Kokybės kontrolei nurodytas kitos kultūros  15.196,04  
 215   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  16.658,25  
 217   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  1.391.972,00  
 219   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Terpė negranuliuota  5.451,60  
 219   UAB 'Linea libera'  39 str. 2 d. 2 p.  Terpė negranuliuota  2.677,50  
 221   Uždaroji akcinė bendrovė "GENERIX"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  5.544,00  
 233   UAB 'Linea libera'  39 str. 2 d. 2 p.  Terpė negranuliuota  1.665,30  
 234   Uždaroji akcinė bendrovė "GENERIX"  39 str. 2 d. 2 p.  Neatitinka specifik., nes kontrolei nenurodyta S. Typhimurium ATCC 14028  218,40  
 242   Uždaroji akcinė bendrovė "GENERIX"  39 str. 2 d. 2 p.  Kokybės kontrolei nurodytas kitos kultūros  4.037,80  
 243   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Kokybės kontrolei nurodytas kitos kultūros  6.187,91  
 244   Uždaroji akcinė bendrovė "GENERIX"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  6.662,25  
 246   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Kokybės kontrolei nurodytas kitos kultūros  4.689,30  
 268   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  861,00  
 269   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolei nurodytas kitos kultūros  378,00  
 269   Uždaroji akcinė bendrovė "GENERIX"  39 str. 2 d. 2 p.  Kokybės kontrolei nurodytas kitos kultūros  386,40  
 270   Uždaroji akcinė bendrovė "GENERIX"  39 str. 2 d. 2 p.  Kokybės kontrolei nurodytas kitos kultūros  214,20  
 271   UAB 'Linea libera'  39 str. 2 d. 2 p.  Terpė negranuliuota  1.498,60  
 272   UAB 'Linea libera'  39 str. 2 d. 2 p.  Terpė negranuliuota  299,72  
 279   UAB "Labochema LT"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  6.693,43  
 279   Uždaroji akcinė bendrovė "GENERIX"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  3.998,40  
 279   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  5.488,35  
 280   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  1.793,60  
 280   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  2.930,55  
 282   UAB 'Linea libera'  39 str. 2 d. 2 p.  Terpė negranuliuota  1.652,00  
 287   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Terpė negranuliuota  1.748,25  
 287   UAB 'Linea libera'  39 str. 2 d. 2 p.  Terpė negranuliuota  1.669,50  
 291   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Neatitinka kokybės kontrolės reikalavimų (pH)  8.761,50  
 296   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Terpė negranuliuota  136,50  
 299   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  5.841,00  
 299   Uždaroji akcinė bendrovė "Bioeksma"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  6.372,00  
 301   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  8.177,40  
 302   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  2.147,60  
 305   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Neatitinka kokybės kontrolės reikalavimų (pH)  2.344,65  
 307   UAB 'Interlux'  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  9.817,60  
 307   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  4.641,00  
 307   Uždaroji akcinė bendrovė "Bioeksma"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  5.138,90  
 307   Uždaroji akcinė bendrovė "GENERIX"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  4.368,00  
 307   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Kokybės kontrolė neatitinka nurodytų padermių.  4.129,13  
 311   Uždaroji akcinė bendrovė "ARDEOLA"  39 str. 2 d. 2 p.  Terpė negranuliuota  3.304,00  
 311   UAB 'Linea libera'  39 str. 2 d. 2 p.  Terpė negranuliuota  2.861,50  
 355   Uždaroji akcinė bendrovė "SUVA"  39 str. 2 d. 2 p.  Pakuotėje 15 lėkšt.  2.671.200,00  
 355   UAB "Oriola–Vilnius"  39 str. 2 d. 2 p.  Pakuotėje 28 lėkšt.  2.469.600,00  
 355   UAB 'Opus Medicum'  39 str. 2 d. 2 p.  atsisakė pateikti  59.220,00  
 377   UAB 'Interlux'  39 str. 2 d. 2 p.  Pasiūlyta kaina yra su aritmetine klaida  1.369,50  
 378   UAB 'Interlux'  39 str. 2 d. 2 p.  Pasiūlyta kaina yra su aritmetine klaida  1.269,90  
 378   UAB 'Opus Medicum'  39 str. 2 d. 2 p.  Pasiūlyta kaina yra su aritmetine klaida  1.269,90  
 387   UAB 'Interlux'  39 str. 2 d. 2 p.  Pasiūlyta kaina yra su aritmetine klaida  81,40  
 387   A. Zapalskio IĮ "Azas"  39 str. 2 d. 2 p.  Pasiūlyta kaina yra su aritmetine klaida  43,89  
 388   UAB 'Interlux'  39 str. 2 d. 2 p.  Adatos turi būti kartu su kraujo ėmimo sistema  891,00  
 388   A. Zapalskio IĮ "Azas"  39 str. 2 d. 2 p.  Adatos turi būti kartu su kraujo ėmimo sistema  323,40  
 389   UAB 'Interlux'  39 str. 2 d. 2 p.  Adatos turi būti kartu su kraujo ėmimo sistema  79,00  
 389   A. Zapalskio IĮ "Azas"  39 str. 2 d. 2 p.  Adatos turi būti kartu su kraujo ėmimo sistema  52,92  
 390   UAB 'Interlux'  39 str. 2 d. 2 p.  Adatos turi būti kartu su kraujo ėmimo sistema  646,40  
 390   A. Zapalskio IĮ "Azas"  39 str. 2 d. 2 p.  Adatos turi būti kartu su kraujo ėmimo sistema  380,72  
 394   UAB "Grida LAB"  39 str. 2 d. 2 p.  Pasiūlyta kaina yra su aritmetine klaida  2.073,85  
 395   UAB "Grida LAB"  39 str. 2 d. 2 p.  Pasiūlyta kaina yra su aritmetine klaida  1.296,42  
 514   UAB "Labochema LT"  39 str. 2 d. 2 p.  Reikalinga 100 mg fasuotė, o pasiūlyta 250 mg fasuotė  135,35  
 514   UAB "Grida LAB"  39 str. 2 d. 2 p.  Reikalinga 100 mg fasuotė, o pasiūlyta 250 mg fasuotė  158,90  
 515   UAB "Labochema LT"  39 str. 2 d. 2 p.  Pasiūlyta kaina yra su aritmetine klaida  310,00  
 527   UAB 'Linea libera'  39 str. 2 d. 2 p.  Reikalinga 1 ml fasuotė, o pasiūlyta 5 ml fasuotė  92,04  
 527   UAB "Grida LAB"  39 str. 2 d. 2 p.  Reikalinga 1 ml fasuotė, o pasiūlyta 5 ml fasuotė  143,00  
 566   UAB "Grida LAB"  39 str. 2 d. 2 p.  Reikalinga 100 mg fasuotė, o pasiūlyta 250 mg fsuotė  164,19  
 688   Uždaroji akcinė bendrovė "Bioeksma"  39 str. 2 d. 2 p.  Pelenų kiekis paliudytoje pamatinėje medžiagoje turėtų būti 0,86±0,02, o pasiūlyta 0,59-0,62g/100 g  330,40  
 690   Uždaroji akcinė bendrovė "Bioeksma"  39 str. 2 d. 2 p.  Reikia, kad paliudytoje pamatinėje medžiagoje būtų : azoto 13,7±0,2; pelenų 4,6±0,2, riebalų 10,8±0,2 , o pasūlyta medžiaga su kitais azoto (2,88 g/100g), pelenų (3,42 g/100g), riebalų (9,19g/100g) kiekiais.  295,00  
 973   UAB "Oriola–Vilnius"  39 str. 2 d. 2 p.  Pateikta klaidinga galutinė suma  280,00  
 981   UAB "Oriola–Vilnius"  39 str. 2 d. 2 p.  Pateikta klaidinga galutinė suma  309,00  
 987   Uždaroji akcinė bendrovė "Bioeksma"  39 str. 2 d. 2 p.  Reikia, kad stiklinės diametras būtų 69-70 mm, o pasiūlyta stiklinė su 50mm diametru  108,56  
 1023   Uždaroji akcinė bendrovė "Bioeksma"  39 str. 2 d. 2 p.  Reikalinga 10/14 mm diametro žarnelė, o pasiūlyta 10/15 mm diametro žarnelė  1.239,00  
 1026   UAB 'Genomas'  39 str. 2 d. 2 p.  Atmesta, nes siūlo ne visą pirkimo dalį  20.203,47  
 1028   UAB 'Interlux'  39 str. 2 d. 2 p.  Atmesta, nes siūlo ne visą pirkimo dalį  2.520,00  
 1029   UAB 'Interlux'  39 str. 2 d. 2 p.  Atmesta, nes inkubacijos laiko trukmė žymiai ilgesnė.  9.192,00  
 1032   UAB 'Genomas'  39 str. 2 d. 2 p.  Atmesta, nes siūlo ne visą pirkimo dalį  6.672,75  
 1032   Uždaroji akcinė bendrovė "Skirgesa"  39 str. 2 d. 2 p.  Atmesta, nes siūlo ne visą pirkimo dalį  1.711,50  
 1034   UAB "Oriola–Vilnius"  39 str. 2 d. 2 p.  Atmesta, nes pasiūlymas pateiktas su aritmetine klaida  180,00  
 1041   UAB "Optinė riba"  39 str. 2 d. 2 p.  Atmesta, nes pasiūlymas pateiktas su aritmetine klaida  26,25  
 1043   Uždaroji akcinė bendrovė "SUVA"  39 str. 2 d. 2 p.  Atmesta, nes pasiūlymas pateiktas su aritmetine klaida  210,04  
 1065   UAB "Baltijos Inoma"  39 str. 2 d. 2 p.  Atmesta, nes pasiūlymas pateiktas su aritmetine klaida  2.157,36  
 1067   Uždaroji akcinė bendrovė "BIOMETRIJA"  39 str. 2 d. 2 p.  Atmesta, nes pasiūlymas pateiktas su aritmetine klaida  58,76  

4. SPRENDIMAS SUDARYTI SUTARTĮ IR INFORMAVIMAS
4.1. Sudaryta pasiūlymų eilė arba priimtas sprendimas dėl laimėjusio pasiūlymo (jei pasiūlymą pateikti kviečiamas vienas tiekėjas arba gautas vienas pasiūlymas)
Pirkimo objekto dalies numeris Patvirtintos/sudarytos pasiūlymų eilės numeris Dalyvio pavadinimas Pasiūlymo (pasiūlymo dalies) ekonominis naudingumas Pasiūlymo (pasiūlymo dalies) kaina Pasiūlymo (pasiūlymo dalies) kainos išraiška
 2  1   UAB 'Linea libera'   1.039,50   
 2  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.253,70   
 2  3   UAB "Diagnostinės sistemos"   1.470,00   
 2  4   UAB "Oriola–Vilnius"   1.510,40   
 2  5   Uždaroji akcinė bendrovė "ARDEOLA"   1.789,20   
 2  6   UAB "DIAMEDICA"   1.908,90   
 3  1   UAB "DIAMEDICA"   1.190,70   
 3  2   UAB 'Linea libera'   1.213,80   
 3  3   UAB 'Interlux'   1.764,00   
 3  4   UAB "Oriola–Vilnius"   2.095,68   
 4  1   UAB "Diagnostinės sistemos"   1.146,60   
 4  2   UAB 'Interlux'   1.224,51   
 4  3   UAB "DIAMEDICA"   1.558,20   
 5  1   UAB 'Linea libera'   373,80   
 5  2   UAB "Diagnostinės sistemos"   420,00   
 6  1   UAB "DIAMEDICA"   998,55   
 6  2   UAB 'Linea libera'   1.423,80   
 7  1   UAB "Oriola–Vilnius"   12.049,80   
 8  1   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   249,38   
 8  2   UAB 'Interlux'   262,50   
 9  1   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   1.152,90   
 9  2   UAB 'Interlux'   1.417,50   
 9  3   UAB 'Genomas'   1.464,75   
 10  1   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   924,00   
 12  1   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   210,00   
 12  2   UAB 'Interlux'   157,50   
 12  3   UAB 'Genomas'   674,73   
 13  1   UAB "Diagnostinės sistemos"   598,50   
 14  1   Uždaroji akcinė bendrovė "ARDEOLA"   433,65   
 14  2   UAB "Diagnostinės sistemos"   598,50   
 15  1   UAB 'Linea libera'   4.880,40   
 16  1   Uždaroji akcinė bendrovė "ARDEOLA"   3.496,50   
 16  2   UAB "Diagnostinės sistemos"   4.651,50   
 16  3   UAB 'Linea libera'   4.782,75   
 16  4   UAB "DIAMEDICA"   4.684,05   
 17  1   Uždaroji akcinė bendrovė "ARDEOLA"   1.936,22   
 17  2   UAB "DIAMEDICA"   2.100,00   
 19  1   Uždaroji akcinė bendrovė "Bioeksma"   5.569,60   
 19  2   UAB 'Interlux'   5.978,59   
 22  1   UAB 'Interlux'   414,12   
 22  2   UAB "Diagnostinės sistemos"   882,00   
 24  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   495,60   
 24  2   UAB "Labochema LT"   530,79   
 26  1   UAB "Labochema LT"   79,77   
 26  2   Uždaroji akcinė bendrovė "Bioeksma"   129,80   
 27  1   UAB "Labochema LT"   2.258,80   
 27  2   Uždaroji akcinė bendrovė "Bioeksma"   2.454,40   
 27  3   UAB 'Interlux'   2.979,26   
 27  4   Uždaroji akcinė bendrovė "ARDEOLA"   3.033,45   
 27  5   UAB "DIAMEDICA"   4.032,00   
 28  1   UAB 'Interlux'   5.308,80   
 28  2   Uždaroji akcinė bendrovė "ARDEOLA"   8.064,00   
 28  3   Uždaroji akcinė bendrovė "Bioeksma"   19.824,00   
 28  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   16.992,00   
 28  5   UAB "Diagnostinės sistemos"   19.824,00   
 29  1   UAB "Diagnostinės sistemos"   966,00   
 29  2   UAB "DIAMEDICA"   1.050,00   
 29  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.524,56   
 29  4   Uždaroji akcinė bendrovė "Bioeksma"   2.076,80   
 31  1   Uždaroji akcinė bendrovė "Bioeksma"   123,90   
 31  2   UAB "Labochema LT"   150,45   
 32  1   UAB 'Interlux'   2.522,52   
 32  2   UAB "Diagnostinės sistemos"   4.914,00   
 32  3   UAB "DIAMEDICA"   9.254,70   
 34  1   UAB "Diagnostinės sistemos"   357,00   
 35  1   UAB 'Interlux'   621,18   
 35  2   UAB "Diagnostinės sistemos"   1.386,00   
 36  1   UAB 'Interlux'   828,24   
 36  2   UAB "Diagnostinės sistemos"   1.848,00   
 37  1   UAB 'Interlux'   490,88   
 39  1   UAB 'Interlux'   368,16   
 41  1   UAB 'Interlux'   368,16   
 42  1   UAB 'Interlux'   368,16   
 44  1   UAB 'Interlux'   613,60   
 45  1   UAB 'Interlux'   368,16   
 46  1   UAB 'Interlux'   552,24   
 47  1   Uždaroji akcinė bendrovė "ANMEDA"   2.322,24   
 47  2   UAB "ILSANTA"   2.576,70   
 47  3   UAB "BIOTECHA"   2.596,17   
 47  4   Uždaroji akcinė bendrovė "Bioeksma"   3.058,56   
 47  5   L. R. Tamulio firma "Meditalika"   4.248,00   
 47  6   UAB 'Interlux'   4.602,00   
 47  7   Uždaroji akcinė bendrovė "BIOMETRIJA"   4.956,00   
 47  8   Uždaroji akcinė bendrovė "DERAIMAS"   5.826,84   
 48  1   Uždaroji akcinė bendrovė "Bioeksma"   1.713,36   
 48  2   L. R. Tamulio firma "Meditalika"   2.478,00   
 48  3   Uždaroji akcinė bendrovė "ANMEDA"   2.577,12   
 48  4   UAB "BIOTECHA"   2.881,56   
 48  5   Uždaroji akcinė bendrovė "DERAIMAS"   3.058,56   
 48  6   Uždaroji akcinė bendrovė "BIOMETRIJA"   3.540,00   
 48  7   UAB 'Interlux'   4.602,00   
 49  1   Uždaroji akcinė bendrovė "ANMEDA"   463,74   
 49  2   Uždaroji akcinė bendrovė "DERAIMAS"   634,84   
 49  3   Uždaroji akcinė bendrovė "Skirgesa"   693,00   
 49  4   UAB "ILSANTA"   787,06   
 49  5   UAB "Optinė riba"   900,00   
 49  6   UAB "BIOTECHA"   905,06   
 49  7   UAB 'Interlux'   1.050,20   
 49  8   L. R. Tamulio firma "Meditalika"   1.062,00   
 49  9   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.180,00   
 49  10   Uždaroji akcinė bendrovė "Bioeksma"   2.124,00   
 50  1   UAB "BIOTECHA"   495,60   
 50  2   Uždaroji akcinė bendrovė "ANMEDA"   867,30   
 50  3   UAB 'Interlux'   1.177,64   
 50  4   Uždaroji akcinė bendrovė "DERAIMAS"   1.879,98   
 50  5   UAB "ILSANTA"   2.454,40   
 50  6   Uždaroji akcinė bendrovė "Skirgesa"   2.360,00   
 50  7   UAB "Optinė riba"   3.000,00   
 50  8   Uždaroji akcinė bendrovė "BIOMETRIJA"   3.894,00   
 50  9   L. R. Tamulio firma "Meditalika"   11.800,00   
 51  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   581,18 (581,175)  
 51  2   UAB 'Linea libera'   623,70   
 51  3   UAB "Labochema LT"   1.173,51   
 52  1   UAB 'Linea libera'   31.436,07   
 52  2   UAB "DIAMEDICA"   32.509,00   
 53  1   UAB "Diagnostinės sistemos"   25.674,60   
 54  1   UAB "Diagnostinės sistemos"   10.198,68   
 55  1   UAB "Diagnostinės sistemos"   12.474,00   
 55  2   Uždaroji akcinė bendrovė "ARDEOLA"   15.595,50   
 56  1   UAB "Diagnostinės sistemos"   3.412,50   
 57  1   UAB "DIAMEDICA"   7.960,05   
 57  2   UAB "Diagnostinės sistemos"   8.279,25   
 57  3   Uždaroji akcinė bendrovė "ARDEOLA"   15.624,00   
 58  1   UAB "DIAMEDICA"   35.658,00   
 59  1   UAB 'Linea libera'   762,30   
 59  2   UAB 'Interlux'   831,60   
 59  3   Uždaroji akcinė bendrovė "ARDEOLA"   2.898,00   
 60  1   UAB 'Linea libera'   69,30   
 60  2   UAB 'Interlux'   90,30   
 61  1   UAB 'Linea libera'   138,60   
 61  2   UAB 'Interlux'   151,20   
 62  1   UAB 'Linea libera'   311,85   
 62  2   UAB 'Interlux'   340,20   
 63  1   Uždaroji akcinė bendrovė "ARDEOLA"   245,70   
 63  2   UAB 'Interlux'   578,20   
 63  3   UAB 'Linea libera'   1.771,35   
 64  1   UAB 'Linea libera'   173,25   
 64  2   UAB 'Interlux'   189,00   
 65  1   UAB 'Linea libera'   138,60   
 65  2   UAB 'Interlux'   226,56   
 65  3   UAB "Diagnostinės sistemos"   2.646,00   
 66  1   UAB "Labochema LT"   156,04   
 66  2   UAB 'Interlux'   245,44   
 67  1   UAB 'Interlux'   360,15   
 67  2   UAB 'Linea libera'   808,50   
 67  3   Uždaroji akcinė bendrovė "ARDEOLA"   929,25   
 67  4   UAB "Labochema LT"   1.534,30   
 68  1   UAB "Labochema LT"   291,22   
 68  2   UAB 'Interlux'   490,88   
 69  1   UAB "Diagnostinės sistemos"   1.134,00   
 70  1   UAB "Labochema LT"   70,12   
 70  2   UAB 'Interlux'   122,72   
 71  1   UAB "Labochema LT"   134,59   
 72  1   UAB "Diagnostinės sistemos"   672,00   
 73  1   UAB 'Interlux'   298,41   
 73  2   UAB 'Linea libera'   669,90   
 73  3   Uždaroji akcinė bendrovė "ARDEOLA"   771,75   
 73  4   UAB "Labochema LT"   1.271,27   
 74  1   UAB 'Interlux'   72,03   
 74  2   Uždaroji akcinė bendrovė "ARDEOLA"   154,35   
 74  3   UAB 'Linea libera'   161,70   
 74  4   UAB "Labochema LT"   306,86   
 75  1   UAB "Labochema LT"   117,03   
 75  2   UAB 'Interlux'   184,08   
 76  1   UAB "Labochema LT"   117,03   
 76  2   UAB 'Interlux'   184,08   
 77  1   UAB "Labochema LT"   437,17   
 77  2   UAB "Diagnostinės sistemos"   2.184,00   
 77  3   Uždaroji akcinė bendrovė "Bioeksma"   300,90   
 78  1   UAB 'Linea libera'   11.744,70   
 79  1   UAB 'Interlux'   21.762,30   
 80  1   UAB "Baltijos Inoma"   7.087,50   
 81  1   UAB "Diagnostinės sistemos"   1.041,60   
 84  1   Uždaroji akcinė bendrovė "GENERIX"   18.967,20   
 84  2   UAB 'Interlux'   23.184,00   
 85  1   Uždaroji akcinė bendrovė "GENERIX"   4.189,50   
 85  2   Uždaroji akcinė bendrovė "ARDEOLA"   5.050,50   
 86  1   UAB 'Interlux'   2.772,00   
 86  2   Uždaroji akcinė bendrovė "GENERIX"   1.789,52   
 87  1   Uždaroji akcinė bendrovė "ARDEOLA"   11.508,00   
 87  2   UAB "Oriola–Vilnius"   33.085,50   
 88  1   Uždaroji akcinė bendrovė "ARDEOLA"   17.199,00   
 88  2   UAB "Oriola–Vilnius"   25.183,20   
 89  1   Uždaroji akcinė bendrovė "ARDEOLA"   28.892,85   
 89  2   UAB "Oriola–Vilnius"   38.869,95   
 90  1   Uždaroji akcinė bendrovė "ARDEOLA"   2.610,30   
 90  2   UAB "Oriola–Vilnius"   3.326,40   
 91  1   Uždaroji akcinė bendrovė "GENERIX"   846,30   
 91  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   941,85   
 91  3   UAB 'Interlux'   1.328,44   
 91  4   UAB "Labochema LT"   2.329,84   
 91  5   Uždaroji akcinė bendrovė "Bioeksma"   3.451,50   
 91  6   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   3.958,50   
 91  7   UAB "BIOTECHA"   6.588,17   
 92  1   Uždaroji akcinė bendrovė "GENERIX"   315,00   
 92  2   UAB "Oriola–Vilnius"   341,25   
 92  3   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   387,45   
 92  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   467,25   
 92  5   Uždaroji akcinė bendrovė "Bioeksma"   649,00   
 92  6   UAB "Labochema LT"   921,82   
 93  1   Uždaroji akcinė bendrovė "Bioeksma"   407,10   
 93  2   Uždaroji akcinė bendrovė "Eksmos" medicininės technikos centras   446,25   
 93  3   UAB "Oriola–Vilnius"   460,20   
 93  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   467,25   
 93  5   Uždaroji akcinė bendrovė "GENERIX"   467,25   
 93  6   UAB "Labochema LT"   973,74   
 94  1   UAB "DIAMEDICA"   14.594,24   
 95  1   UAB "BIOTECHA"   315,06   
 95  2   UAB "Labochema LT"   414,18   
 95  3   UAB "Grida LAB"   424,80   
 95  4   UAB "Baltijos Inoma"   1.362,90   
 95  5   UAB 'Interlux'   1.486,80   
 96  1   UAB "Grida LAB"   200,60   
 96  2   UAB "Baltijos Inoma"   222,47   
 96  3   UAB "BIOTECHA"   228,92   
 96  4   UAB 'Interlux'   406,14   
 97  1   UAB "BIOTECHA"   245,44   
 97  2   UAB "Grida LAB"   259,60   
 97  3   UAB "Labochema LT"   292,17   
 97  4   UAB "Baltijos Inoma"   602,41   
 98  1   UAB "Labochema LT"   45,23   
 98  2   UAB "Grida LAB"   62,30   
 98  3   UAB "Baltijos Inoma"   79,40   
 99  1   UAB "Labochema LT"   45,23   
 99  2   UAB "Grida LAB"   62,30   
 99  3   UAB "Baltijos Inoma"   79,40   
 100  1   UAB "Labochema LT"   52,76   
 100  2   UAB "Grida LAB"   72,69   
 100  3   UAB "Baltijos Inoma"   92,63   
 101  1   UAB "Labochema LT"   41,45   
 101  2   UAB "Grida LAB"   57,11   
 101  3   UAB "Baltijos Inoma"   72,78   
 102  1   UAB "Labochema LT"   37,69   
 102  2   UAB "Grida LAB"   51,92   
 102  3   UAB "Baltijos Inoma"   66,16   
 103  1   UAB "Labochema LT"   37,69   
 103  2   UAB "Grida LAB"   51,92   
 103  3   UAB "Baltijos Inoma"   66,16   
 104  1   UAB "Labochema LT"   39,58   
 104  2   UAB "Grida LAB"   54,52   
 104  3   UAB "Baltijos Inoma"   69,48   
 105  1   UAB "Labochema LT"   45,23   
 105  2   UAB "Grida LAB"   62,30   
 105  3   UAB "Baltijos Inoma"   79,40   
 106  1   UAB "Labochema LT"   54,65   
 106  2   UAB "Grida LAB"   75,28   
 106  3   UAB "Baltijos Inoma"   95,95   
 107  1   UAB "Labochema LT"   54,65   
 107  2   UAB "Grida LAB"   75,28   
 107  3   UAB "Baltijos Inoma"   95,95   
 108  1   UAB "Baltijos Inoma"   1.513,79   
 108  2   UAB "Grida LAB"   2.124,00   
 108  3   UAB 'Interlux'   2.922,86   
 109  1   UAB "BIOTECHA"   123,90   
 109  2   UAB "Grida LAB"   184,08   
 109  3   UAB "Baltijos Inoma"   216,01   
 109  4   UAB "Labochema LT"   426,15   
 109  5   UAB 'Interlux'   1.181,65   
 110  1   UAB 'Interlux'   96,60   
 110  2   UAB "Baltijos Inoma"   143,63   
 110  3   UAB "Labochema LT"   161,24   
 110  4   UAB "Grida LAB"   177,00   
 110  5   UAB "BIOTECHA"   505,04   
 111  1   UAB "Labochema LT"   245,02   
 111  2   Uždaroji akcinė bendrovė "Bioeksma"   365,80   
 112  1   UAB "Labochema LT"   204,48   
 112  2   Uždaroji akcinė bendrovė "Bioeksma"   365,80   
 113  1   UAB "Labochema LT"   245,02   
 113  2   Uždaroji akcinė bendrovė "Bioeksma"   365,80   
 114  1   UAB "Labochema LT"   204,48   
 114  2   Uždaroji akcinė bendrovė "Bioeksma"   365,80   
 115  1   UAB "Baltijos Inoma"   107,11   
 115  2   UAB "BIOTECHA"   116,76   
 115  3   Uždaroji akcinė bendrovė "GENERIX"   126,00   
 115  4   UAB "Oriola–Vilnius"   129,74   
 115  5   UAB "Labochema LT"   150,98   
 115  6   UAB "Grida LAB"   271,40   
 116  1   Uždaroji akcinė bendrovė "GENERIX"   47,25   
 116  2   UAB "Baltijos Inoma"   76,84   
 116  3   Uždaroji akcinė bendrovė "Bioeksma"   105,02   
 116  4   UAB "Oriola–Vilnius"   110,26   
 116  5   UAB "BIOTECHA"   156,53   
 116  6   UAB "Labochema LT"   169,65   
 116  7   UAB "Grida LAB"   206,50   
 117  1   UAB "Optinė riba"   22,80   
 117  2   Uždaroji akcinė bendrovė "SUVA"   25,05   
 117  3   Uždaroji akcinė bendrovė "Bioeksma"   44,84   
 117  4   UAB "Baltijos Inoma"   48,68   
 117  5   UAB "Oriola–Vilnius"   67,02   
 117  6   UAB "BIOTECHA"   76,39   
 117  7   UAB "Labochema LT"   81,94   
 117  8   Uždaroji akcinė bendrovė "GENERIX"   99,75   
 117  9   UAB "Grida LAB"   106,20   
 118  1   UAB "Oriola–Vilnius"   37,64   
 118  2   UAB "Baltijos Inoma"   43,85   
 118  3   Uždaroji akcinė bendrovė "GENERIX"   47,25   
 118  4   UAB "BIOTECHA"   60,89   
 118  5   Uždaroji akcinė bendrovė "Bioeksma"   62,54   
 118  6   UAB "Labochema LT"   87,62   
 118  7   UAB "Grida LAB"   129,80   
 120  1   UAB "Baltijos Inoma"   176,54   
 120  2   Uždaroji akcinė bendrovė "GENERIX"   283,50   
 120  3   Uždaroji akcinė bendrovė "Bioeksma"   306,80   
 120  4   UAB "Oriola–Vilnius"   307,27   
 120  5   Uždaroji akcinė bendrovė "BIOMETRIJA"   419,14   
 120  6   UAB "Grida LAB"   506,10   
 120  7   UAB "Labochema LT"   669,82   
 121  1   UAB "Oriola–Vilnius"   277,30   
 121  2   UAB "Grida LAB"   506,10   
 122  1   UAB "Baltijos Inoma"   174,10   
 122  2   Uždaroji akcinė bendrovė "Bioeksma"   271,40   
 122  3   UAB "Oriola–Vilnius"   277,30   
 122  4   Uždaroji akcinė bendrovė "GENERIX"   283,50   
 122  5   UAB "BIOTECHA"   311,05   
 122  6   UAB "Grida LAB"   472,50   
 122  7   Uždaroji akcinė bendrovė "BIOMETRIJA"   498,43   
 122  8   UAB "Labochema LT"   625,87   
 123  1   UAB "Baltijos Inoma"   176,54   
 123  2   Uždaroji akcinė bendrovė "Bioeksma"   271,40   
 123  3   UAB "Oriola–Vilnius"   277,30   
 123  4   Uždaroji akcinė bendrovė "GENERIX"   283,50   
 123  5   UAB "BIOTECHA"   311,05   
 123  6   UAB "Grida LAB"   494,55   
 123  7   UAB "Labochema LT"   654,90   
 124  1   UAB "Oriola–Vilnius"   37,17   
 124  2   UAB "Baltijos Inoma"   83,00   
 124  3   UAB "Grida LAB"   210,00   
 124  4   UAB "BIOTECHA"   486,04   
 124  5   Uždaroji akcinė bendrovė "Bioeksma"   743,40   
 124  6   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.168,20   
 125  1   UAB "Oriola–Vilnius"   18,88   
 125  2   UAB "BIOTECHA"   31,10   
 125  3   UAB "Grida LAB"   105,00   
 125  4   Uždaroji akcinė bendrovė "Bioeksma"   224,20   
 126  1   Uždaroji akcinė bendrovė "SUVA"   11,00   
 126  2   UAB "Oriola–Vilnius"   11,33   
 126  3   UAB "Labochema LT"   17,70   
 127  1   UAB "Labochema LT"   14,41   
 127  2   Uždaroji akcinė bendrovė "Bioeksma"   177,00   
 128  1   A. Tamošiūno įmonė   47,78   
 128  2   A. Zapalskio IĮ "Azas"   59,33   
 128  3   Uždaroji akcinė bendrovė "Skirgesa"   73,50   
 128  4   UAB "Oriola–Vilnius"   89,25   
 128  5   UAB "Optinė riba"   100,00   
 128  6   Uždaroji akcinė bendrovė "SUVA"   107,38   
 128  7   Uždaroji akcinė bendrovė "GENERIX"   118,00   
 128  8   UAB "Labochema LT"   125,38   
 128  9   UAB "Baltijos Inoma"   148,68   
 129  1   UAB "Baltijos Inoma"   916,95   
 130  1   Uždaroji akcinė bendrovė "Bioeksma"   82,60   
 130  2   UAB "BIOTECHA"   200,47   
 131  1   Uždaroji akcinė bendrovė "SUVA"   9,77   
 131  2   Uždaroji akcinė bendrovė "GENERIX"   15,34   
 132  1   UAB 'Interlux'   61.675,58   
 133  1   UAB "Oriola–Vilnius"   27.995,50   
 133  2   UAB "Labochema LT"   48.256,10   
 133  3   Uždaroji akcinė bendrovė "Bioeksma"   38.232,00   
 134  1   UAB 'Opus Medicum'   35.532,00   
 134  2   Uždaroji akcinė bendrovė "GENERIX"   36.855,00   
 134  3   UAB "Grida LAB"   48.852,00   
 134  4   UAB "Optinė riba"   54.450,00   
 134  5   Uždaroji akcinė bendrovė "SUVA"   82.836,00   
 134  6   UAB "BIOTECHA"   82.836,00   
 135  1   UAB 'Opus Medicum'   201,60   
 135  2   UAB "Optinė riba"   225,00   
 135  3   UAB "Oriola–Vilnius"   267,75 (267,750)  
 135  4   UAB 'Interlux'   267,75 (267,750)  
 135  5   Uždaroji akcinė bendrovė "GENERIX"   299,25   
 135  6   UAB "Grida LAB"   796,50   
 135  7   Uždaroji akcinė bendrovė "SUVA"   885,00   
 135  8   UAB "Labochema LT"   902,70   
 135  9   Uždaroji akcinė bendrovė "Bioeksma"   955,80   
 136  1   UAB "Oriola–Vilnius"   48.825,00   
 136  2   Uždaroji akcinė bendrovė "Bioeksma"   61.950,00   
 136  3   Uždaroji akcinė bendrovė "GENERIX"   63.000,00   
 136  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   65.625,00   
 136  5   UAB 'Interlux'   78.960,00   
 136  6   Uždaroji akcinė bendrovė "SUVA"   79.650,00   
 136  7   UAB "Grida LAB"   80.850,00   
 136  8   UAB "Labochema LT"   95.580,00   
 136  9   UAB "BIOTECHA"   152.220,00   
 137  1   Uždaroji akcinė bendrovė "Bioeksma"   61.124,00   
 137  2   UAB "Oriola–Vilnius"   61.740,00   
 137  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   72.030,00   
 137  4   Uždaroji akcinė bendrovė "GENERIX"   73.500,00   
 137  5   UAB 'Interlux'   75.021,45   
 137  6   UAB "Labochema LT"   89.125,40   
 137  7   Uždaroji akcinė bendrovė "SUVA"   99.120,00   
 137  8   UAB "Grida LAB"   116.300,80   
 137  9   UAB "BIOTECHA"   175.310,24   
 138  1   UAB "Oriola–Vilnius"   987,00   
 138  2   Uždaroji akcinė bendrovė "Bioeksma"   991,20   
 138  3   UAB "Baltijos Inoma"   1.188,02   
 138  4   Uždaroji akcinė bendrovė "GENERIX"   1.239,00   
 138  5   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.239,00   
 138  6   UAB "Labochema LT"   1.334,34   
 138  7   Uždaroji akcinė bendrovė "SUVA"   1.534,00   
 138  8   UAB 'Interlux'   1.659,00   
 139  1   UAB "Oriola–Vilnius"   28.642,95   
 139  2   UAB 'Opus Medicum'   29.097,60   
 139  3   UAB 'Interlux'   31.825,50   
 139  4   UAB "Optinė riba"   32.258,50   
 139  5   Uždaroji akcinė bendrovė "BIOMETRIJA"   33.644,10   
 139  6   Uždaroji akcinė bendrovė "SUVA"   40.875,20   
 139  7   UAB "BIOTECHA"   51.094,00   
 139  8   Uždaroji akcinė bendrovė "Bioeksma"   54.159,64 (54159,640)  
 139  9   Uždaroji akcinė bendrovė "GENERIX"   59.104,50   
 139  10   UAB "Grida LAB"   60.035,45   
 139  11   UAB "Labochema LT"   68.976,90   
 140  1   UAB "Oriola–Vilnius"   9.393,30   
 140  2   UAB 'Interlux'   10.437,00   
 140  3   UAB "Optinė riba"   10.650,00   
 140  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   11.033,40   
 140  5   UAB 'Opus Medicum'   12.524,40   
 140  6   Uždaroji akcinė bendrovė "SUVA"   13.404,80   
 140  7   UAB "BIOTECHA"   16.756,00   
 140  8   Uždaroji akcinė bendrovė "Bioeksma"   17.761,36   
 140  9   Uždaroji akcinė bendrovė "GENERIX"   19.383,00   
 140  10   UAB "Grida LAB"   19.688,30   
 140  11   UAB "Labochema LT"   22.620,60   
 141  1   UAB 'Interlux'   5,31   
 141  2   A. Tamošiūno įmonė   15,48   
 141  3   A. Zapalskio IĮ "Azas"   17,33   
 141  4   Uždaroji akcinė bendrovė "Skirgesa"   25,41   
 141  5   UAB "Optinė riba"   30,80   
 141  6   UAB "Oriola–Vilnius"   32,34   
 141  7   Uždaroji akcinė bendrovė "GENERIX"   43,89   
 141  8   Uždaroji akcinė bendrovė "SUVA"   51,92   
 142  1   A. Zapalskio IĮ "Azas"   822,15   
 142  2   UAB 'Opus Medicum'   1.141,88   
 142  3   UAB "Optinė riba"   1.725,50   
 142  4   UAB "Oriola–Vilnius"   1.827,00   
 142  5   Uždaroji akcinė bendrovė "Bioeksma"   2.053,20   
 142  6   Uždaroji akcinė bendrovė "GENERIX"   2.131,50   
 142  7   UAB 'Interlux'   2.131,50   
 142  8   UAB "Grida LAB"   6.501,80   
 143  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   29.594,40   
 143  2   UAB "Oriola–Vilnius"   34.078,40   
 143  3   Uždaroji akcinė bendrovė "GENERIX"   39.459,20   
 143  4   Uždaroji akcinė bendrovė "SUVA"   41.252,80   
 143  5   UAB "Grida LAB"   42.328,96   
 143  6   Uždaroji akcinė bendrovė "Bioeksma"   46.633,60   
 143  7   UAB 'Opus Medicum'   53.808,00   
 144  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   12.980,00   
 144  2   UAB "Oriola–Vilnius"   13.127,50   
 144  3   Uždaroji akcinė bendrovė "SUVA"   15.340,00   
 144  4   Uždaroji akcinė bendrovė "Bioeksma"   15.930,00   
 144  5   UAB "Grida LAB"   17.700,00   
 145  1   UAB "Oriola–Vilnius"   23.541,00   
 145  2   Uždaroji akcinė bendrovė "Bioeksma"   34.692,00   
 145  3   UAB "BIOTECHA"   34.800,41   
 145  4   L. R. Tamulio firma "Meditalika"   35.105,00   
 145  5   Uždaroji akcinė bendrovė "GENERIX"   161.070,00   
 146  1   UAB "Oriola–Vilnius"   201,78   
 146  2   Uždaroji akcinė bendrovė "SUVA"   329,22   
 146  3   UAB "BIOTECHA"   387,12   
 146  4   Uždaroji akcinė bendrovė "Bioeksma"   389,40   
 146  5   L. R. Tamulio firma "Meditalika"   531,00   
 146  6   Uždaroji akcinė bendrovė "GENERIX"   1.486,80   
 147  1   UAB "Oriola–Vilnius"   828,36   
 147  2   UAB 'Linea libera'   1.168,20   
 147  3   UAB "BIOTECHA"   1.939,64   
 148  1   UAB "Oriola–Vilnius"   354,00   
 148  2   UAB 'Linea libera'   542,80   
 148  3   Uždaroji akcinė bendrovė "GENERIX"   672,00   
 148  4   UAB "BIOTECHA"   924,51   
 149  1   UAB 'Linea libera'   283,20   
 149  2   UAB "BIOTECHA"   765,84   
 150  1   UAB 'Linea libera'   159,30   
 150  2   UAB "BIOTECHA"   398,39   
 151  1   Uždaroji akcinė bendrovė "GENERIX"   924,00   
 151  2   UAB 'Interlux'   1.092,00   
 151  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.888,00   
 152  1   UAB "DIAMEDICA"   716,26   
 153  1   UAB "Baltijos Inoma"   196,73   
 153  2   UAB "Oriola–Vilnius"   307,74   
 153  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   358,72   
 153  4   Uždaroji akcinė bendrovė "GENERIX"   462,56   
 153  5   Uždaroji akcinė bendrovė "Bioeksma"   490,88   
 153  6   Uždaroji akcinė bendrovė "SUVA"   516,75   
 153  7   UAB "Labochema LT"   581,50   
 153  8   UAB "Grida LAB"   604,16   
 153  9   UAB "BIOTECHA"   745,76   
 153  10   UAB 'Interlux'   5.286,40   
 154  1   UAB "Grida LAB"   11.115,60   
 155  1   UAB "Oriola–Vilnius"   269,04   
 155  2   UAB "Labochema LT"   591,18   
 156  1   UAB "DIAMEDICA"   1.008,90   
 156  2   UAB 'Linea libera'   2.409,75   
 156  3   Uždaroji akcinė bendrovė "Bioeksma"   4.354,20   
 156  4   Uždaroji akcinė bendrovė "GENERIX"   5.299,38   
 156  5   UAB "Labochema LT"   7.126,02   
 157  1   UAB 'Linea libera'   8.011,50   
 158  1   UAB "Oriola–Vilnius"   259,60   
 159  1   UAB "Oriola–Vilnius"   129,80   
 160  1   UAB "Oriola–Vilnius"   306,80   
 160  2   Uždaroji akcinė bendrovė "SUVA"   336,60   
 160  3   Uždaroji akcinė bendrovė "GENERIX"   519,20   
 160  4   UAB "Labochema LT"   951,08   
 161  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   401,20   
 161  2   Uždaroji akcinė bendrovė "GENERIX"   1.840,80   
 161  3   Uždaroji akcinė bendrovė "SUVA"   2.380,30   
 162  1   A. Tamošiūno įmonė   567,00   
 162  2   A. Zapalskio IĮ "Azas"   625,59   
 162  3   Uždaroji akcinė bendrovė "Skirgesa"   756,00   
 162  4   Uždaroji akcinė bendrovė "GENERIX"   980,91   
 162  5   Uždaroji akcinė bendrovė "SUVA"   1.104,48   
 162  6   UAB "Optinė riba"   1.080,00   
 163  1   A. Tamošiūno įmonė   71,82   
 163  2   A. Zapalskio IĮ "Azas"   71,82   
 163  3   Uždaroji akcinė bendrovė "Skirgesa"   89,78   
 163  4   UAB "Optinė riba"   95,00   
 163  5   Uždaroji akcinė bendrovė "GENERIX"   135,66   
 163  6   Uždaroji akcinė bendrovė "SUVA"   143,49   
 164  1   A. Tamošiūno įmonė   1.561,88   
 164  2   Uždaroji akcinė bendrovė "Skirgesa"   1.785,00   
 164  3   A. Zapalskio IĮ "Azas"   1.785,00   
 164  4   UAB "Optinė riba"   2.210,00   
 164  5   Uždaroji akcinė bendrovė "BIOMETRIJA"   4.012,00   
 164  6   Uždaroji akcinė bendrovė "GENERIX"   4.569,60   
 164  7   Uždaroji akcinė bendrovė "SUVA"   5.476,38   
 165  1   UAB "Oriola–Vilnius"   161,07   
 165  2   Uždaroji akcinė bendrovė "Skirgesa"   240,03   
 165  3   UAB "Optinė riba"   300,00   
 165  4   Uždaroji akcinė bendrovė "SUVA"   514,54   
 166  1   Uždaroji akcinė bendrovė "Skirgesa"   269,80   
 166  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   270,81   
 166  3   UAB "Oriola–Vilnius"   334,53   
 166  4   UAB "Optinė riba"   360,00   
 166  5   Uždaroji akcinė bendrovė "SUVA"   1.124,13   
 167  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   61,95   
 167  2   Uždaroji akcinė bendrovė "Skirgesa"   74,97   
 167  3   UAB "Oriola–Vilnius"   83,19   
 167  4   UAB "Optinė riba"   105,00   
 167  5   UAB "Labochema LT"   226,56   
 167  6   Uždaroji akcinė bendrovė "SUVA"   227,98   
 168  1   Uždaroji akcinė bendrovė "Skirgesa"   139,97   
 168  2   UAB "Optinė riba"   160,00   
 168  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   177,00   
 168  4   UAB "Labochema LT"   267,15   
 168  5   Uždaroji akcinė bendrovė "SUVA"   267,27   
 169  1   UAB "Labochema LT"   38,00   
 169  2   Uždaroji akcinė bendrovė "SUVA"   102,52   
 169  3   Uždaroji akcinė bendrovė "Skirgesa"   117,60   
 169  4   UAB "Optinė riba"   136,00   
 169  5   UAB "Oriola–Vilnius"   311,52   
 169  6   Uždaroji akcinė bendrovė "Bioeksma"   320,96   
 170  1   UAB "BIOTECHA"   599,72   
 170  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   778,80   
 170  3   Uždaroji akcinė bendrovė "Bioeksma"   1.097,40   
 171  1   Uždaroji akcinė bendrovė "Bioeksma"   92.394,00   
 171  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   100.677,60   
 171  3   UAB "BIOTECHA"   110.235,60   
 171  4   UAB "Labochema LT"   127.440,00   
 172  1   UAB "BIOTECHA"   155,84   
 172  2   Uždaroji akcinė bendrovė "Bioeksma"   424,80   
 173  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.569,40   
 173  2   UAB "Oriola–Vilnius"   2.578,30   
 173  3   Uždaroji akcinė bendrovė "Bioeksma"   3.363,00   
 174  1   A. Zapalskio IĮ "Azas"   141,75   
 174  2   UAB 'Opus Medicum'   165,38   
 174  3   Uždaroji akcinė bendrovė "GENERIX"   184,28   
 174  4   UAB "Optinė riba"   202,50   
 174  5   Uždaroji akcinė bendrovė "Skirgesa"   212,40   
 174  6   UAB "Labochema LT"   238,95   
 174  7   Uždaroji akcinė bendrovė "BIOMETRIJA"   259,88   
 174  8   UAB 'Interlux'   259,88   
 174  9   UAB "Oriola–Vilnius"   278,78   
 175  1   UAB 'Opus Medicum'   73,50   
 175  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   99,23   
 175  3   Uždaroji akcinė bendrovė "Skirgesa"   103,25   
 175  4   Uždaroji akcinė bendrovė "GENERIX"   110,25   
 175  5   A. Zapalskio IĮ "Azas"   159,50   
 175  6   UAB "Labochema LT"   227,15   
 175  7   UAB "Oriola–Vilnius"   248,01   
 175  8   UAB "Optinė riba"   276,50   
 175  9   UAB 'Interlux'   290,33   
 176  1   UAB 'Opus Medicum'   105,00   
 176  2   UAB "Labochema LT"   123,90   
 176  3   Uždaroji akcinė bendrovė "GENERIX"   131,25   
 176  4   Uždaroji akcinė bendrovė "Skirgesa"   147,50   
 176  5   UAB "Oriola–Vilnius"   201,78   
 176  6   UAB "Optinė riba"   220,00   
 176  7   UAB 'Interlux'   244,13   
 176  8   A. Zapalskio IĮ "Azas"   260,40   
 176  9   Uždaroji akcinė bendrovė "BIOMETRIJA"   262,50   
 177  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   3.882,20   
 177  2   UAB "Oriola–Vilnius"   4.130,00   
 177  3   Uždaroji akcinė bendrovė "GENERIX"   5.586,00   
 177  4   Uždaroji akcinė bendrovė "SUVA"   6.608,00   
 177  5   UAB "Labochema LT"   7.599,20   
 177  6   UAB 'Opus Medicum'   14.868,00   
 178  1   UAB 'Opus Medicum'   2.053,20   
 178  2   Uždaroji akcinė bendrovė "SUVA"   5.440,98   
 178  3   UAB "Oriola–Vilnius"   8.418,12   
 178  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   9.650,04   
 178  5   UAB "Labochema LT"   10.676,64   
 179  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.947,71   
 179  2   Uždaroji akcinė bendrovė "GENERIX"   2.601,90   
 179  3   UAB 'Opus Medicum'   5.947,20   
 179  4   Uždaroji akcinė bendrovė "SUVA"   7.434,00   
 180  1   UAB 'Opus Medicum'   2.076,80   
 180  2   UAB "Oriola–Vilnius"   7.164,96   
 180  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   7.580,32   
 180  4   UAB "Labochema LT"   8.826,40   
 181  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.150,50   
 181  2   UAB "Labochema LT"   2.070,90   
 181  3   Uždaroji akcinė bendrovė "SUVA"   2.849,70   
 182  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   259,60   
 182  2   UAB "Labochema LT"   2.006,00   
 183  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   177,00   
 183  2   UAB "Oriola–Vilnius"   177,00   
 183  3   Uždaroji akcinė bendrovė "GENERIX"   273,00   
 183  4   UAB "Labochema LT"   330,40 (330,400)  
 183  5   Uždaroji akcinė bendrovė "SUVA"   731,60 (731,600)  
 184  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   112,10   
 184  2   Uždaroji akcinė bendrovė "SUVA"   879,10   
 184  3   UAB "Labochema LT"   1.787,70   
 185  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   169,92   
 185  2   UAB "Baltijos Inoma"   174,56   
 185  3   UAB "Oriola–Vilnius"   180,54   
 185  4   Uždaroji akcinė bendrovė "GENERIX"   277,20   
 185  5   UAB "Grida LAB"   283,20   
 185  6   UAB "Labochema LT"   364,62   
 186  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   509,76   
 186  2   Uždaroji akcinė bendrovė "SUVA"   986,81   
 187  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   424,80   
 187  2   Uždaroji akcinė bendrovė "SUVA"   1.595,30   
 188  1   Uždaroji akcinė bendrovė "SUVA"   531,77   
 190  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   247,80   
 190  2   UAB "Labochema LT"   1.088,55   
 191  1   UAB "Oriola–Vilnius"   160,24   
 191  2   Uždaroji akcinė bendrovė "Bioeksma"   330,40   
 192  1   A. Tamošiūno įmonė   3.118,50   
 192  2   UAB "BIOTECHA"   3.260,84   
 192  3   A. Zapalskio IĮ "Azas"   3.527,37   
 192  4   Uždaroji akcinė bendrovė "Skirgesa"   3.603,60   
 192  5   L. R. Tamulio firma "Meditalika"   4.809,42   
 192  6   UAB "Optinė riba"   4.620,00   
 193  1   Uždaroji akcinė bendrovė "Bioeksma"   219,48   
 193  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   244,26   
 193  3   UAB "Oriola–Vilnius"   271,87   
 193  4   Uždaroji akcinė bendrovė "SUVA"   279,66   
 193  5   UAB "Grida LAB"   293,82   
 193  6   UAB "BIOTECHA"   321,04   
 193  7   UAB "Optinė riba"   345,00   
 193  8   UAB "Labochema LT"   372,80   
 194  1   Uždaroji akcinė bendrovė "Skirgesa"   73,50   
 194  2   UAB "Optinė riba"   100,00   
 194  3   A. Zapalskio IĮ "Azas"   252,00   
 195  1   A. Tamošiūno įmonė   113,19   
 195  2   A. Zapalskio IĮ "Azas"   120,96   
 196  1   UAB "Labochema LT"   121,25   
 196  2   UAB "Oriola–Vilnius"   146,91   
 196  3   Uždaroji akcinė bendrovė "Bioeksma"   230,10   
 196  4   Uždaroji akcinė bendrovė "SUVA"   907,48   
 196  5   Uždaroji akcinė bendrovė "BIOMETRIJA"   2.814,30   
 197  1   Uždaroji akcinė bendrovė "SUVA"   131,39   
 197  2   UAB "Oriola–Vilnius"   141,01   
 197  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   141,60   
 197  4   UAB "Labochema LT"   199,54   
 197  5   UAB 'Linea libera'   4.720,00   
 198  1   Uždaroji akcinė bendrovė "SUVA"   131,39   
 198  2   UAB "Oriola–Vilnius"   141,01   
 198  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   141,60   
 198  4   UAB "Labochema LT"   199,54   
 198  5   UAB 'Linea libera'   4.720,00   
 199  1   UAB "ILSANTA"   866,25   
 199  2   UAB "Labochema LT"   1.014,28   
 200  1   UAB "Labochema LT"   44,18   
 200  2   Uždaroji akcinė bendrovė "SUVA"   167,47   
 200  3   Uždaroji akcinė bendrovė "GENERIX"   179,36   
 200  4   UAB "ILSANTA"   245,44   
 200  5   UAB "BIOTECHA"   432,35   
 200  6   Uždaroji akcinė bendrovė "Bioeksma"   424,80   
 201  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   35,40   
 201  2   A. Tamošiūno įmonė   37,80   
 201  3   Uždaroji akcinė bendrovė "Skirgesa"   42,00   
 201  4   A. Zapalskio IĮ "Azas"   42,48   
 201  5   UAB "Optinė riba"   52,00   
 202  1   A. Tamošiūno įmonė   197,39   
 202  2   A. Zapalskio IĮ "Azas"   269,61   
 202  3   Uždaroji akcinė bendrovė "Skirgesa"   535,50   
 202  4   UAB "Optinė riba"   612,00   
 202  5   UAB "Labochema LT"   640,32   
 202  6   UAB "Oriola–Vilnius"   1.969,09   
 203  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   3.955,36   
 203  2   UAB "Optinė riba"   5.200,00   
 203  3   UAB "Labochema LT"   6.088,80   
 203  4   Uždaroji akcinė bendrovė "SUVA"   7.481,39   
 203  5   UAB "BIOTECHA"   8.614,00   
 203  6   Uždaroji akcinė bendrovė "Bioeksma"   9.217,69   
 204  1   UAB "Grida LAB"   440,38   
 204  2   UAB "BIOTECHA"   495,60   
 204  3   UAB "Oriola–Vilnius"   594,72   
 204  4   Uždaroji akcinė bendrovė "Bioeksma"   637,20   
 204  5   Uždaroji akcinė bendrovė "SUVA"   679,68   
 204  6   Uždaroji akcinė bendrovė "BIOMETRIJA"   693,84   
 204  7   UAB "Labochema LT"   1.302,72   
 205  1   Uždaroji akcinė bendrovė "SUVA"   1.221,30   
 206  1   Uždaroji akcinė bendrovė "SUVA"   271,40   
 207  1   Uždaroji akcinė bendrovė "SUVA"   1.911,60   
 208  1   A. Zapalskio IĮ "Azas"   843,70 (843,700)  
 208  2   Uždaroji akcinė bendrovė "SUVA"   1.116,28 (1113,280)  
 209  1   Uždaroji akcinė bendrovė "SUVA"   1.146,96   
 210  1   Uždaroji akcinė bendrovė "SUVA"   1.327,50   
 211  1   Uždaroji akcinė bendrovė "SUVA"   1.150,50   
 212  1   UAB 'Interlux'   567,11 (567,110)  
 213  1   Uždaroji akcinė bendrovė "GENERIX"   386,40   
 213  2   UAB 'Interlux'   614,54   
 213  3   UAB 'Linea libera'   693,00   
 213  4   Uždaroji akcinė bendrovė "Bioeksma"   693,00   
 213  5   UAB "Labochema LT"   1.184,72   
 214  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   22.420,00   
 215  1   UAB 'Linea libera'   19.624,50   
 215  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   21.986,94   
 215  3   UAB 'Interlux'   25.268,52   
 215  4   Uždaroji akcinė bendrovė "GENERIX"   52.069,50   
 215  5   UAB "Labochema LT"   151.792,84   
 216  1   Uždaroji akcinė bendrovė "ARDEOLA"   459,90   
 216  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   657,72   
 216  3   UAB 'Linea libera'   806,40   
 216  4   UAB 'Interlux'   1.335,29   
 217  1   UAB 'Linea libera'   15.426,60   
 217  2   UAB 'Interlux'   26.561,80   
 218  1   UAB 'Linea libera'   1.466,85   
 218  2   UAB "Labochema LT"   3.408,43   
 219  1   Uždaroji akcinė bendrovė "Bioeksma"   5.841,00   
 219  2   UAB 'Interlux'   7.965,00   
 219  3   UAB "Labochema LT"   11.204,10   
 220  1   Uždaroji akcinė bendrovė "Bioeksma"   7.375,00   
 220  2   UAB 'Linea libera'   7.612,50   
 220  3   UAB "Labochema LT"   13.717,50   
 220  4   UAB 'Interlux'   13.806,00   
 221  1   UAB 'Linea libera'   6.930,00   
 221  2   Uždaroji akcinė bendrovė "ARDEOLA"   9.204,00   
 221  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   10.011,12   
 221  4   Uždaroji akcinė bendrovė "Bioeksma"   12.602,40   
 221  5   UAB 'Interlux'   14.726,40   
 222  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   157,29   
 222  2   UAB 'Linea libera'   207,90   
 222  3   UAB 'Interlux'   264,32   
 223  1   UAB 'Linea libera'   7.113,75   
 223  2   Uždaroji akcinė bendrovė "GENERIX"   7.875,00   
 224  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   138,06   
 224  2   Uždaroji akcinė bendrovė "Bioeksma"   672,60   
 225  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   797,68   
 225  2   UAB 'Linea libera'   1.467,92   
 226  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.150,28   
 226  2   UAB 'Linea libera'   1.381,80   
 226  3   Uždaroji akcinė bendrovė "ARDEOLA"   1.925,70   
 226  4   Uždaroji akcinė bendrovė "GENERIX"   1.940,40   
 226  5   UAB 'Interlux'   2.841,44   
 226  6   UAB "DIAMEDICA"   3.219,30   
 226  7   Uždaroji akcinė bendrovė "Bioeksma"   3.304,00   
 226  8   UAB "Labochema LT"   5.012,17   
 227  1   UAB 'Linea libera'   680,40   
 228  1   UAB "Labochema LT"   1.059,64   
 229  1   UAB 'Linea libera'   1.293,60   
 229  2   UAB 'Interlux'   2.570,04   
 229  3   UAB "Labochema LT"   7.593,30   
 230  1   UAB 'Linea libera'   522,90   
 230  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   633,66   
 230  3   Uždaroji akcinė bendrovė "ARDEOLA"   888,54   
 230  4   UAB 'Interlux'   991,20   
 230  5   Uždaroji akcinė bendrovė "GENERIX"   1.398,60   
 231  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   778,80   
 232  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.555,24   
 232  2   Uždaroji akcinė bendrovė "ARDEOLA"   2.973,60   
 232  3   UAB 'Linea libera'   3.465,00   
 232  4   Uždaroji akcinė bendrovė "GENERIX"   3.528,00   
 232  5   UAB 'Interlux'   4.460,40   
 232  6   UAB "Labochema LT"   7.108,08   
 233  1   Uždaroji akcinė bendrovė "Bioeksma"   1.840,80   
 233  2   Uždaroji akcinė bendrovė "ARDEOLA"   1.932,84   
 233  3   Uždaroji akcinė bendrovė "GENERIX"   1.938,30   
 233  4   UAB 'Interlux'   2.899,26   
 233  5   UAB "Labochema LT"   3.581,89   
 234  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   230,10   
 234  2   Uždaroji akcinė bendrovė "Bioeksma"   318,60   
 234  3   Uždaroji akcinė bendrovė "ARDEOLA"   325,68   
 234  4   UAB 'Interlux'   446,04   
 234  5   UAB "DIAMEDICA"   510,30   
 234  6   UAB "Labochema LT"   598,26   
 235  1   UAB 'Linea libera'   1.275,75   
 236  1   Uždaroji akcinė bendrovė "GENERIX"   130,20   
 236  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   149,99   
 236  3   UAB "Labochema LT"   257,38   
 236  4   UAB 'Interlux'   521,56   
 237  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   539,85   
 237  2   UAB 'Interlux'   899,16   
 237  3   UAB "Labochema LT"   1.671,94   
 238  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   657,30   
 238  2   UAB 'Interlux'   1.557,60   
 238  3   Uždaroji akcinė bendrovė "Bioeksma"   2.360,00   
 239  1   Uždaroji akcinė bendrovė "Bioeksma"   736,32   
 239  2   UAB "Labochema LT"   1.442,34   
 239  3   UAB 'Interlux'   4.172,48   
 240  1   UAB 'Linea libera'   50.913,90   
 240  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   60.734,36   
 240  3   Uždaroji akcinė bendrovė "GENERIX"   71.353,80   
 240  4   Uždaroji akcinė bendrovė "Bioeksma"   89.514,80   
 240  5   Uždaroji akcinė bendrovė "ARDEOLA"   89.715,40   
 241  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   894,60   
 241  2   UAB 'Linea libera'   1.795,50   
 241  3   Uždaroji akcinė bendrovė "ARDEOLA"   3.209,60   
 241  4   UAB "Labochema LT"   4.070,41   
 242  1   UAB 'Linea libera'   5.105,10   
 243  1   UAB 'Linea libera'   7.259,70   
 243  2   Uždaroji akcinė bendrovė "ARDEOLA"   9.528,75   
 244  1   UAB 'Linea libera'   7.386,75   
 244  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   9.415,35   
 244  3   Uždaroji akcinė bendrovė "Bioeksma"   23.293,20   
 245  1   UAB 'Linea libera'   588,00   
 245  2   UAB "Labochema LT"   1.133,86   
 245  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   2.242,00   
 246  1   UAB 'Linea libera'   5.370,75   
 246  2   Uždaroji akcinė bendrovė "GENERIX"   7.449,75   
 246  3   Uždaroji akcinė bendrovė "Bioeksma"   9.735,00   
 246  4   UAB 'Interlux'   25.895,10   
 246  5   UAB "Labochema LT"   31.833,45   
 247  1   UAB 'Interlux'   727,20   
 247  2   Uždaroji akcinė bendrovė "ARDEOLA"   1.354,50   
 247  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.387,58   
 247  4   UAB 'Linea libera'   1.401,75   
 247  5   Uždaroji akcinė bendrovė "Bioeksma"   1.982,40   
 247  6   UAB "DIAMEDICA"   3.134,25   
 247  7   UAB "Labochema LT"   4.237,38   
 250  1   UAB 'Linea libera'   9.207,45   
 250  2   Uždaroji akcinė bendrovė "Bioeksma"   10.216,44   
 250  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   10.609,38   
 250  4   Uždaroji akcinė bendrovė "GENERIX"   13.286,70   
 250  5   UAB 'Interlux'   13.752,90   
 250  6   Uždaroji akcinė bendrovė "ARDEOLA"   14.145,84   
 250  7   UAB "Labochema LT"   22.856,01   
 251  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   561,68   
 251  2   Uždaroji akcinė bendrovė "ARDEOLA"   759,92   
 251  3   UAB 'Linea libera'   1.239,00   
 251  4   UAB 'Interlux'   1.239,00   
 251  5   UAB "Labochema LT"   1.803,16   
 252  1   UAB 'Linea libera'   30.758,40   
 253  1   UAB 'Interlux'   6.421,56   
 254  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   74,87   
 254  2   Uždaroji akcinė bendrovė "Bioeksma"   147,50   
 254  3   UAB 'Linea libera'   190,05   
 254  4   UAB "Labochema LT"   300,02   
 255  1   UAB 'Linea libera'   7.901,20   
 255  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   9.592,22   
 255  3   Uždaroji akcinė bendrovė "ARDEOLA"   13.900,40   
 255  4   Uždaroji akcinė bendrovė "Bioeksma"   21.830,00   
 256  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   17.935,58   
 256  2   UAB 'Linea libera'   25.759,40   
 256  3   Uždaroji akcinė bendrovė "ARDEOLA"   29.747,80   
 257  1   UAB 'Linea libera'   47,25   
 257  2   Uždaroji akcinė bendrovė "GENERIX"   138,60   
 257  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   180,72   
 257  4   UAB 'Interlux'   438,96   
 258  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   876,96   
 258  2   UAB 'Linea libera'   1.387,68   
 258  3   UAB 'Interlux'   2.227,84   
 258  4   UAB "Labochema LT"   2.843,42   
 259  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   821,63   
 259  2   Uždaroji akcinė bendrovė "ARDEOLA"   1.102,50   
 259  3   Uždaroji akcinė bendrovė "GENERIX"   1.144,50   
 259  4   UAB 'Linea libera'   1.302,00   
 259  5   UAB 'Interlux'   1.640,20   
 259  6   UAB "DIAMEDICA"   1.743,00   
 259  7   UAB "Labochema LT"   4.643,30   
 260  1   UAB 'Linea libera'   2.770,95   
 260  2   Uždaroji akcinė bendrovė "GENERIX"   3.319,05   
 260  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   5.851,62   
 261  1   UAB 'Linea libera'   874,65   
 261  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   920,96   
 261  3   Uždaroji akcinė bendrovė "GENERIX"   1.073,10   
 261  4   UAB 'Interlux'   1.387,68   
 261  5   UAB "Labochema LT"   2.610,16   
 261  6   Uždaroji akcinė bendrovė "Bioeksma"   3.386,60   
 262  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.478,48   
 262  2   UAB 'Linea libera'   1.911,60   
 262  3   Uždaroji akcinė bendrovė "Bioeksma"   1.947,00   
 262  4   UAB 'Interlux'   2.973,60   
 262  5   UAB "DIAMEDICA"   3.024,00   
 262  6   UAB "Labochema LT"   3.981,62   
 263  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.932,00   
 263  2   UAB 'Linea libera'   2.058,00   
 263  3   Uždaroji akcinė bendrovė "GENERIX"   2.646,00   
 263  4   UAB 'Interlux'   3.256,80   
 263  5   Uždaroji akcinė bendrovė "Bioeksma"   3.492,80   
 263  6   Uždaroji akcinė bendrovė "ARDEOLA"   4.620,00   
 263  7   UAB "DIAMEDICA"   5.124,00   
 264  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   2.127,51   
 264  2   UAB "Labochema LT"   3.520,18   
 264  3   Uždaroji akcinė bendrovė "GENERIX"   5.279,40   
 265  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   2.568,93   
 265  2   UAB 'Linea libera'   2.866,50   
 265  3   Uždaroji akcinė bendrovė "ARDEOLA"   3.374,80   
 265  4   Uždaroji akcinė bendrovė "GENERIX"   4.477,20   
 265  5   Uždaroji akcinė bendrovė "Bioeksma"   5.737,16   
 265  6   UAB 'Interlux'   8.437,00   
 266  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   3.079,69   
 266  2   UAB 'Interlux'   6.580,86   
 266  3   UAB 'Linea libera'   7.009,20   
 266  4   Uždaroji akcinė bendrovė "Bioeksma"   7.437,54   
 266  5   UAB "Labochema LT"   10.227,59   
 267  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   487,31   
 267  2   Uždaroji akcinė bendrovė "GENERIX"   771,75   
 267  3   Uždaroji akcinė bendrovė "Bioeksma"   1.065,54   
 267  4   UAB "Labochema LT"   2.198,89   
 268  1   UAB 'Linea libera'   1.085,60   
 268  2   Uždaroji akcinė bendrovė "GENERIX"   1.102,50   
 268  3   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.109,20   
 268  4   Uždaroji akcinė bendrovė "Bioeksma"   1.392,40   
 268  5   UAB "Labochema LT"   5.620,44   
 269  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   405,92   
 269  2   Uždaroji akcinė bendrovė "Bioeksma"   528,64   
 269  3   UAB 'Linea libera'   579,60   
 269  4   UAB "Labochema LT"   1.194,16   
 270  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   221,84   
 270  2   UAB 'Linea libera'   289,80   
 270  3   UAB "Labochema LT"   486,99   
 271  1   Uždaroji akcinė bendrovė "Bioeksma"   1.805,40   
 271  2   Uždaroji akcinė bendrovė "ARDEOLA"   1.888,00   
 271  3   UAB "Labochema LT"   3.616,70   
 272  1   Uždaroji akcinė bendrovė "Bioeksma"   377,60   
 272  2   Uždaroji akcinė bendrovė "ARDEOLA"   429,52   
 272  3   UAB "Labochema LT"   600,03   
 273  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   128,10   
 273  2   UAB 'Linea libera'   157,50   
 273  3   Uždaroji akcinė bendrovė "Bioeksma"   325,68   
 273  4   Uždaroji akcinė bendrovė "ARDEOLA"   330,40   
 274  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   630,12   
 274  2   UAB 'Linea libera'   1.295,64   
 275  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   313,88   
 275  2   UAB 'Linea libera'   236,00   
 276  1   UAB 'Interlux'   1.783,32   
 276  2   Uždaroji akcinė bendrovė "BIOMETRIJA"   4.257,33   
 276  3   UAB 'Linea libera'   5.220,60   
 276  4   Uždaroji akcinė bendrovė "ARDEOLA"   5.313,00   
 276  5   Uždaroji akcinė bendrovė "Bioeksma"   5.451,60   
 276  6   Uždaroji akcinė bendrovė "GENERIX"   6.375,60   
 276  7   UAB "DIAMEDICA"   9.193,80   
 276  8   UAB "Labochema LT"   13.239,60   
 277  1   Uždaroji akcinė bendrovė "Bioeksma"   3.871,58   
 277  2   UAB 'Interlux'   2.991,60   
 278  1   Uždaroji akcinė bendrovė "ARDEOLA"   1.392,30   
 278  2   UAB 'Interlux'   2.166,48   
 278  3   Uždaroji akcinė bendrovė "GENERIX"   2.177,70   
 278  4   UAB 'Linea libera'   2.246,72   
 278  5   UAB "Labochema LT"   3.249,72   
 279  1   UAB 'Linea libera'   8.395,80   
 280  1   UAB 'Linea libera'   3.727,50   
 280  2   Uždaroji akcinė bendrovė "GENERIX"   4.310,25   
 281  1   UAB "Labochema LT"   1.338,12   
 281  2   UAB 'Linea libera'   1.349,92   
 281  3   UAB 'Interlux'   1.604,80   
 281  4   Uždaroji akcinė bendrovė "BIOMETRIJA"   1.864,40   
 282  1   Uždaroji akcinė bendrovė "Bioeksma"   2.194,80   
 282  2   Uždaroji akcinė bendrovė "ARDEOLA"   2.242,00   
 282  3   UAB 'Interlux'   3.516,40   
 282  4   UAB "Labochema LT"   3.665,08   
 283  1   UAB 'Linea libera'   205,80   
 283  2   Uždaroji akcinė bendrovė "Bioeksma"   344,56   
 284  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   4.046,70 (4046,700)  
 284  2   UAB 'Linea libera'   4.326,00   
 285  1   Uždaroji akcinė bendrovė "BIOMETRIJA"   317,52   
 285  2   Uždaroji akcinė bendrovė "GENERIX"   428,40   
 285  3   Uždaroji akcinė bendrovė "Bioeksma"   700,92   
 285  4   Uždaroji akcinė bendrovė "ARDEOLA"   756,00   
 285  5   UA